Description :
From Genome Similarity Track
Location :
Scaffold_1090:5068- 8838
Transcript NameFunction/comments
g15980.t1hypothetical protein

Sequence
3770 bases(100 bases per row)
TTTATCAGCTCAGGCAATTAACTGTTTTGGTTGTAAAGGGACACGTGTCAGCTTTTTGGGAATCTTTTTTAATATTTTTTTTAGCAGCAAGGCATCATAG
GCATTAAAGGGCCGTACAAACCCCGAGTTTGAGCGCAGACTGCACCAAACCAACGGTTTTCCACCGGTACCACTGCAAATGGCCACCGTCGAGCGGTCCT
CACTTGTCACAATAGTGCCGACTCGTCCTTTTGATTGGAAAGTGTCCGCCACAGCCGTAACTGCACAGAAACCCAAATAGCATGTTACCACACTACGGGC
CGGTCCCATTACACGGCATCAAGCCCGAGGCTAGGCCGGCTTTTATCGCCGTGTGTACCCACCCCAGTCCCCCGGATTGGTATGAGACTTCCCACTATGC
TCGCGAGCATAAATGGGCGCCTCAGCACCGCGGCTCCGAAGAGCAGGTTGGATGGCGGACTGTCTTGGAACGCATTTCGGGCGCCAGCTGCAATCTTTTT
ATCGGACCTCTAACCTGGAATTATGCTTCCCGGGGGGGAAGGGAGCCCCCCAAAATAGCATGTTCACCAGAAAGCCCGAAAATACGGGGTAACCGTCACG
ATTGCTTCGAGAGAGGTCGGCCTGGCTCGCTGGGCAGGGATGGGATCCTCTTGGGGGCTGGCTAGGCCGCATCAGTGTGGCCGTCATAGGGTACCCATCC
CTCCATGCAGTTGTGCCCTTCCCACACAATGCACGGCTCCGGTTATCCTCCTCTAACACGCACGGTTACCCCTCGACTGCCCTGAAGGTACCAGTTATCC
GCAACAGGCGGCACTCCCGAAATCGTTATGTATTAGAATTAAATAGGATTAATCTATACCTACCCTGCCTGCGGCGGGGATGACCTGCCTGCGAAGCTAT
CCCGCCCGGTCCTCCGTTGAGCTGGTCCGTCGCCGGAGCGTCGTTTTGAAAATGGAAATGAAAAGAAACGTTGTTGAAAGGCGGTTTATTTTGTCCAATC
AGCAGCGATTTCATTCGGCTACTTCCGATGTGATGTAGTCCACTCTACGCATTATAATAGCCAATCGCGCAGAAGTTCCACTAAATAGCCAATAAGAGGG
CTTGAATTATAATAATAGCGAATGGGAGGGCCGCCTTCGCTGCGCTCGGCAGCTATTTATAGCCAACGGAAAGTCCGGATTTGCGTTACGCTCGAGGTGC
GTACGGAATGACGGACAGACGGACGGACGGACGGACGGACGGACAGGTTACTCTGTTACTTGTAGGAGACTAGCCGAGCGCCGCCCGCGTTGCGGGCGGT
GGGTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGCTTCACTACTGTTTTTGCTATGACAGGCTTATGTTTTATATCAGTATATTTTACA
GTAGACTTGTATCAAAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTTCGCTTGTCTAGCATGCACTGTTTGATCCTGGGTTTTCACCCGCGTGCTT
CGCACACGGACTTCAAACCACAGGCGTACTCGCTGCGCTCGTCTCACGTGGTTCCCGTGTGTACGAACCCTAAGCCCGCTGCGGCTCGCAAGCTTCGCCT
CCGCTTGTCTAGCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCGCAGGCGTACTCGCTGCGCTCGTCTCACGTG
GTCCCCGTGTGTACGAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTACCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCTT
CGCACACGGACTTCAAACCGCAGGCGTACTCGCTGCGCTCGTCTCACGTGGTTCCCGTGTGTACGAACCCTAAGTCCGCTACGGCTCGCAAGCTTCGCCT
CCGCTTGTCTAGCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCACAGGCGTACTCGCTGCGCTCGCCTCCTCAG
TATGTGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTGTTCCTCCCGCTCTGGATACTCGACCAATGC
CTTGAATCTCGACCTCGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTT
TGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCAAAATGGGAAATCGCGGATGTCGCCATCGCTGA
TGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATAGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGACG
CGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATG
TTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAACTGGTCCAGTCATGCGAT
CCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGAT
GTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAGTAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATG
AGCATGTCACGTGGAATCTTAATGTAGTCATTTCCCAGATCATTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCA
TTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACCGTTCGGATGACTTCAGGCA
TGCGTCGATTGTCTCTGTAGCCGAGCCGCCCTTCACCACCGGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCACGTATGGGAATGAAAAGAAAAGT
TGTTGAAAGGCGGTTTATTTTGTCCAATCAGCATCAGTGATTTCAGTCCGCTAATTCCGATGTGGTGTAGTCCACACTACGCATTATAATAGCCAATCGC
GCAGAGTTTCCACTATATAGCCAATGAGAGGGCTCGAATCATAATATTGGCGAATGGGGAGGCCGCCTTCGCTGCGCTCGGCAGCTATTTATAGCCAACG
GAAAGTCCGGATTTGCGTTACCCTCGAGGTGCGTACGGAATGACGGACAGACGGACGGACGGACGGACAGGTTACTCTGTTACTTGTAGGAGACTAGCCG
AGCGCCGCCCGCGTTGCGGGCGGTGGGGGCATGGTTGGTTGGTGCCCGTTTGCTCGCTCATCCAGCTCGCTTCACTACTATTTTTACTATGACAGGGTTA
TGTTTTATATCAGTATATTTTACAGTAGACTTGTATCAAAACCCTAAGCCCGCTACAGCTCGCAAGCTTCGCCTTCGCTTGTCTACCATGCACTGTTTGG
TCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCACAGGCGTACTCGCTACGCTCGTCTCACGTGGTTCCCGTGTGTACGAATCCTAAGCC
CGCTACGGCTCGCAAGCTTCGCCTCCGCTTATCTAGCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGT