Description :
From Genome Similarity Track
Location :
scaffold_160:50677- 52086
Sequence
1409 bases(100 bases per row)
ATGCAAGTTGGTCTGGGTAAAGCTGGTTTGGATCCTAACCAGCCATCTGGGGTGAGACTACTGGGTTCTGGTCCTCGGCGAGTTCCGTCAGCTTGTCCAA
TTTCATGGGTTGTTGATGCTGTGCTGTCTTATTGTCGAGGCGTGCATTGAGACGTGTGATACGCATGTTCATTATTTCCCCAGTCGTATTATTGTTGTCA
GCACCGGGGCCCCCGCTACTTGGAACTGATATTCCGCTTCCTGTCGGTAAACCATTTTCTAGCACGTCCAAGACATCCATAGGAGCTTCCGCGAGATGTG
TGACTGCCCCAACAATGAGGTCAACTAAATCGCCAATCTCGCTGAAATCCAGAGTCATCACTTTCAAGGCCACTTTGGCAAGTTTGAAGGTAACCAGAAC
CAGCAGCACCGACCAAGCCCAACAAATGCGCCCTACTCGTTTGCGGTATGATTCGGTGACAATTGCATGCGTCACATACTGCTTGACATACGTTGCAGCA
GTGTGGATTTCGCCTAACAATTTGTTGTCATGATCTTCGTGAACGGCCACGAAGACATTCCAGTCCAATGAGTCTTGGCCATGACGGTCATGATATCGGT
TCAATGTCCGCGCCAAATCTGTCATCTTGGATCACCCTCAGTGTATTGACCTTCGCTCACAATTGTGTTGATGCAGCGCAAGACAGCGTTGATACGCAGA
TTGACTCTGGAGGCGACACGTTGCTCCCAGTCTCCTTTTTTTCGAGAAGCTTCACCTCGGCTGCACAATCGACCGTTCTTAGCAATCACGTCACCTAGCG
TGTAAGCGTCCTGCGCTCCCCAGTTGAAGATCAAATTCGCGTACCGGATCCGAAATACTTCAAACTGCAGTCGATGAGCATTGTCAATTGCTTCCAGTGA
CTGCTGGAGTACAACGATCACCAACTTTTGTTTTTCAATCGACTGCAACTGGAAAATCTCCTCCACAGCGCGCACATCTGTCACCTTATGCGCGATTTTG
TGCATGGTGATGGTCTTCGCTGCTTCCTTCACCTTCTTCATCTCCTCTTTCGTAAACCCATTTCGCTTCAGCCAGTAGTAGAAATCATCGTGAGTCAGAA
CTGGGGCTGATCTCTTAAACTGGCATGATTTTACTGCAGCACTGATTGGCATGAAGAGCACATAAGGAGTAAGGAAGACGATCATAAGCGCAATCCCGCG
GATATTGCAAATGAAATAGACGATGCCTTTAAGTGGTAAGCAAATGTAATACTTGATCTTCGCACATAGAGTCAGGGGTGGTGCTGGCGGGTATACGCGA
TGATCGTCTGTCCAATGCGAAATCCAGGCGGGGTTGAGTGTAACAGGAAGCTCTGCAACTATTTTGTGGTTGCAATCCGCCACACCTTTGAATGTGTAAG
TTTTTGGTG