Description :
From Genome Similarity Track
Location :
Scaffold_1221:5067- 6514
Sequence
1447 bases(100 bases per row)
TTCCGCCCAGTATGCTCGCGCGATCGGCCCGCCTCGCGCCGCGCGGCGCGCGCTCCTTCTTCTCCGCCCCGGCGTCCGCCCAGGCCCACCAGTACGCGCT
CGACGTCGAGTTCCCCGGGGTCTCCCGCGCCACGGCCAACGCGGCGCCGCTCCCCAAGCCCACGACCGCGACGGCCACGTCCNNNNNNNNNNCAAGCTCG
CGTCCGACACTGGCGACCACTTTGTGGCGACCCTGGGCGTCGAGATCGCCGCCGGCGCGCGCACCGAGAGCGACGACACGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCTCTCGCAGCTCTTTGCGCACATGGCGTTCCGCACGACCGCGACGCGGTCGGACCTGCGTCTCTTCC
GCGACATTGAGGCCATTGGCGGCGTCGTCCACAAGCACGCCGGCCGCGACTTTGTGCGCTACAGCGTGAGTGTGCTGCCGCACCATCTCGAGAGCGCCGC
CGAGATCCTCGCCGAGACGACGCTCGCGCCGCGGTACGTGCCGTGGGACATTGACCAGATCAAGCAGCAGGTCGCCGTGGAAGCCGCGGCATCGGCCGCG
TGCTCGGAACGCACCGTGTGGGAAAACGTCCACGCCGCGGCGTTCTACGACGACGCGACGCTCGGCCGCTCGCCGTTTGCCGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGCCGACGACCTCGCGGCCTTCCACGCCCAGTACGTCAACACGGCGTCGCTCGCGTTGGTCGGGTCGGGTGTGGA
CCAAGCCACGCTCACGTCGCTCGCCAACAGCTTTTTCGATGGCGTTCCCTCGGCCTCGGCGGTCGCCAAGAAGACGCCGGCCAAGTTTGTGGGTGGCGAG
TCCCGTGTCAAGAAGAACGGCGTCAAGAACACGTTCGTCGCGCTCGGGTTCCCGACCGCCGGTGCCCATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGCTCGAGGCGCTGCTGACCAAGCGTCTCCACAGCAAGAAGGCTGCGGGCTTTGCGGCCACGTACACCGACGCCGGCCTCGTGGGCTTGCGTGG
CTTTGCCGCGCCCGCGGACGCCGGCTCGCTCGTCGATGCGTTTGCGGCCGAGATCAAGAAGGCTGCGTCGGCGGCGCCGTCCACCGAGGAGCTCGCGGCC
GCCAAGACTGNNNNNNNNNNNNNNNNNNNNNNNGAGCTCCTGTCGCGATTGGGCAAGCTCGCGTTCCTCGGTACGGCCGCCCACGCGCAGGCCGTTGCGA
CGCCGCTGGCCAATGTGCAGGCCGTGACGGCCAAGCACGTCCAGGAACTCGCGCAGAAGGCGATCGCGTCGCGACCGGCGCTCGCGTCCGTGGGCAAGCT
CGCAGCCGTGCCGCGTCTGGACGCGCTCGTCCAGAAGCTCAAGTAGA