Description :
From Genome Similarity Track
Location :
Scaffold_11:50657- 58525
Transcript NameFunction/comments
Physo_130345predicted protein

Sequence
7868 bases(100 bases per row)
AGCCGAGACCGAGTCTGATTATTACTGGATTTATTTTGCCGGCCCGTCGAACAGCGGGAGGGATCAGCACTGCGGGAGTTGACAAAACAAACTCGCCGTC
TAATAACGTTGGGATGCTGTATCTGCCGGGTAGCTAGCTAGCTCTTCACTACAACATCAGCTAAGTTCGTGGCGCGCATTCCTTTTCAGTTTTTTTATCA
TTCCAATACAGGCGTAGTCTGCCAAAATCGACTTTCAACCTTTGCGTACCCGATCTGAAGTTCGTTGGCTCATGTCACTTGCCTGCCAGGAACAATTCCT
GCTTACAACGCTAGCCGCAATTTGCACCGTGAACAAAGGCGGCGTCCGCTGTTCGAATGCGTACGACCAATGGAATCCGCTGTCCGGTCCAGCCGTGGGA
TGACCGGCAAAGCTACCTCGCACCGGGACAACTTCAACTTGGCCAGGCAGCGTGGGCCTCCAAAGACACGTAGCAACAGCAATGTACATGTATTGCGCCA
CCCCACCCTTGCATGCACTACATGTACATTGGAGGCTACCCGCCCTCTTCGGGCCAAACCCAATTGCTTGGCCATCAACGGAAGCTGGAGCCTAGTACTC
CAGGACCGACGAGCTCCACCAGAACGATCGCTCACTTCTCAATTTGCTTCCTTCTCGACAAGGCACGGCAGCAAGACGATGACGTTCAAGGCTCGACTGC
ATCACGCAGTGGCGCTCTTCGGCTGCATCGCGCTGGTCTCCACTCTCGCTTCCTTGGCTCATGCGCAAACCACCGTCTCCGCTGGAGGCTCCGGCGTGCA
CATCCTGTTCCAAACCGACAAGTGGGTGACGCCCTACATCCACTACAAGGCCGGCACCGGCAGCTGGACCACGTCGCCCGGCGTGGCCATGGCCGCCAGC
ACCAACTCCGCGTACCCGGCGAAGGACGGCTGGTTCCAGTTCGACGCTGCCTCGGCCACGTCGCTCGAGTTCGTCTTCAATGACGGAGTCGGCATCGTCT
GGGACAACAACAACAACGCCAACTACAAGGTCTCGGCGGCCGGCTCCTACTCGGTCGTGAGCAAGGTGTCCGGCTTCAAGACGGGCGATCTCGTTCGCCC
GAGTGATGGCACGGGCTACCACATCCTCTTCCAGCCCGTCACGTGGGCCAAGCCTTACATCCACTTCAACGCCGGCAGCGGCTGGACCACCGTGTCCGGG
TACGCCATGACGGCCAGCACGTACGCCGGCAAGTTCTCGGCTGCCAACGGCTGGTACCAGTACGATATCTCGTCCACGTCGTCTGTGGAAATCGCCTTCA
ATGACGGCAACGGAGTATGGGACAGCAACCTCAACGCCAACTACGTGCGCTCATCGCCTGGCGCCTACGCGTTCGTGAACCAGAACACGCAGACGCCCAC
GTCGGCCCCGTCCGTCCAGGGCTACGTCAATGGGCCCGGGTACGCTGTCACGTCCACCAGCGAGTCGGCCGGTGTGCTCACCATTAACCTGCAGGTGAAC
TCGGCCGCCACGGCCACCTCGTACGGCTCGGACCTGTCGGCGCTCGTGGTCACGGTCGCCAAGACGGAGAGCGACAGCGTGCGCGTCAAGATCGTGGACA
AGAACAACAAGCGCTGGGAGGTGCCCAAGAGCATCTTCACGGCCGGCACGCTGGGGGCCGACAGCACCGCCACGGCCGCCGCAGCGGACCCGCTGTACAC
CTTCAACTACACGCAGAACCCCTTCACGTTCCAGGTGACGCGCAAGTCGGACGGCTACACGTTGTTCGACTCGTCGGGCATCTCGCTCGTGGTCAAGGAC
CAGTACCTGCAGGCGTCCACGGTGCTGGGCAGCGACCTGAGCGTCTACGGCATCGGCGAGAGCACGCGCGAGAACTTCAAGATGGCGTCGGGCGACAAGC
AAACGCTCTGGGCCCGCGACCAAGGATCCGCGTCCGCCAACGTCAACACGTACGGCTCGCACCCGTTCTTCCTCGGCGTCAACAGCGCCGGCCAGGCCCA
CGGCGTGCTCCTGCTCAACAGCAACGGCATGGACGTGACCATGGACAGCGGCCACCTCGTGTACCAGACGATCGGCGGCGTGCTCGACTTCAACATCGTG
GTGGGCCCCACGCCGGCCAACGTCGTCTCGCAGTACACGAAGCTCATCGGCCGGCCGAAGCTCATGCCGTACTGGTCGTACGGCTTCCACCAGTGCCGAT
GGGGCTACGGCTCTGTCGACGCGCTGCGCACGGTCGTGAGCAAGTACGCGAGCAACAAGCTGCCGCTGGACGTCATCTGGTCCGACATCGACTACATGAG
GAGCTACCACGACTTCACGCTGGACCCGACCAACTTCCCGCAGGCCAAGATGGCCGCCTTCATGGACGAGATCCACGCCGCCGGCCAGAAGTTCGTGCCG
ATCATCGACCCCGGCATCCCGGACGACACCAACGACTACGCGTACACGAAGGGCCTGTCGATGGATATCTTCATCAAGGACACGAGCGGTAAGCCGTACC
TGGGCCAGGTGTGGCCTGGGCCGACGGTGTTCCCCGACTTCTTCCACCCGAACGCCAAGTCTTACTGGGGTGAGCAGATCCAGCTCATGTACAAAAACTT
CGCCTTCGATGGCCTCTGGATCGACATGAATGAGCTCGCGAACTTCTGCCCTGGAACGACTTGCGTGCGTCAGTCGGGCGTAACTTGCCCGAACACTGGA
AGCATCAATGCCATCACGACGTGTTGCTTGAGCTGCTCGGGTGACGGCAACAAGTACGACAACCCGCCGTTCAAGATCAACAACGTCAACAGCCACGACG
CCATCTACAACAAGGGGATCTCCACCAGTGCGTTACAGTACGGCAACATCCGCCAGTACGACGCGCACAACCTGTACGGCATCACCGAATCCATCGTGAC
CAATTCCGTTCAGGAGGAGCTGGCCAACAAGAGGTCCTTCGTGCTCTCTCGGTCGACGTTCCCCGGCAGCGGTGTCCACGTGGCTCACTGGACCGGTGAC
AACGCCGCTACTTGGAACGACCTGCGGTGGTCGATCCCCACTATCCTCAAGTTCGGACTCTTCGGCATCCCCATGGTTGGTGCCGACATCTGCGGATTCT
CTGGTGCTTCCAACATGGAGCTTTGCGCGCGTTGGACGGCTCTGGGCTCGTTCTACCCGTTCTCGCGTAACCACAACAACCTCGAAGCTCCTTCGCAGGA
GACGTACGTGTGGCCTGAGGTGACTACCGTGGGCCAGAAGTTCGTTGGCATGCGCTACCGACTCCTGCCGTACATCTACACGCTCGGATACCACGCGCAC
GCTGAAGGTCTCCCCATCGCTCGTCCGCTGCTGATGGAGTTCCCGACCGACACTGCCACGTACAGCATCAACTACCAGTTCATGCTGGGCAACGCGTTGC
TGGTGACCCCCGTGGTGAACCAGGGAGCGTCGTCCGCGACCGGCTACTACCCGGCCGGTGTCTGGTACAACATCTTCGACTACTCCAAGATCACCAGCAC
CGGTGGATCTGTGACGACGGCGGTGACTCTGTACGACATGCCGGTGCACATTCGCGGAGGAACCATCTTGGCCATGCACCAGTCGGCTCTCACCAGCACG
GCCGCTCGCCTCACCCCGTTCGACATCTTGGTCGCTCTACCGGCCAGTGGCAGCGCCAGCGGAGACCTGTACCTGGACGATGGCGAGACCGTCAGCAACC
CGAGCGCCACCATCGTCAAGTTCACCGCCTCGGCCGGTACGTTCACGTCCACGGTGTCGCAGAACGACTATGCGGGTGCTCGCTCGAGTCTGGTGAACAA
GGTGATCGTTCTCGGTGTGACGTCGGCGCCCTCGAGCGTGTCGGTCGGCTCCATTTCCAAGTACGACTCGGCCACGCAGCGCCTGGAGATCAGTCTCGCG
AATGTGAACCATAGCATCGCCTCGGGCTTCACGATCACGTGGAAGTAAACGGAACTCGTCCGAATCCGCAGGTGCTTCGGGCAGTATCAGTCGTTGCAGC
TTTGGCTCCAAAATATCGCTCTTTCGATGAGGTTTAGCTAGCTTTCGAAGTAAACTAATGTTAGGTTGGACATGTCTTATGAAGTTTGCAGGCGTATTCA
CGTGAACTTGTATTCACCTCCCAACCCGTCCCAGGAATACACCAAAAAGCACAGCAGAACCACTTGGGCATTCATGGGAACATCATCGAAATCGTCGACC
AGCTCGTAGATTGGCCACAGCTTGATTGCAAGATCGGGAGGGGTTGGCGTCTGGTCCGTGTTCTGTAGTAGAGCCCCCGCAAACAAGTCGACCCCAGGAA
TCGTGACGAAATCATCGACTCCATGCCACGGGTTGGCAGGAAACAACTCGTCGGGGGATCGGACGGGAACAAAAGCTGCAGACTTCGTAGTGGTTGGCCC
ACTTCCCTCGCCGAAACTACAGATCGAGCGGGGCGCTGCCGAAGCTCACCGCGTCGCCAATCACCACCGACTGACCAGGCGCTTCTCGAAGGTAGACGAT
GGCCACGCACGCAAACGTTCTGTCTTCTTGGCGGCGAAAGAACTTCACCAAGAGCACAGCGCGTAATTCTGGGAGCATGTCGAAGAATCTGCGGCAATGG
CTCTGAGCTGCCGGTAGGCTTCGCTGTGGAAATTCAACCTCAACAATCAATCGAGGCTGAATGGGGCTGTCTCCAGCAGTTGAGTGTCTCGGGCGAAGAG
CAGTTTCCGGTCGAATCATAACACGGAAGTGACCTCCTGGGAGACCTCCTGGGATCTCTAATTCCATGGTTCCTCCCCCAACAGCTAAGATGCTGCCCGT
GTTTCTCGTGTAAACAAGTATTTGGCCAGTTACTTCTGCAGCAGCTTGTGTATGGGCTATTCCTTGGACTTTAGTGATGAAAACGTCAACCAAACTTGGA
TCTGCTTCAGTGTACCGCGCTTCGAAATACACAAACGGAATGCTGCCGATATTGCTCCGTCGCCATTGCTCCAGAGGCACACGCTGCGCCACGAGCACTT
CGACGTCGTGTTCTCCATTCCTAGACGACGTTCATACTCACGGATAGCAGAATCACGCTGGATGCCCGTGACCTGGCCAGTTAGTGGCTCGTATTCTGTC
GCCATCTCCAGGAGGATTTTTCAAAAGTACAGGAAGTCAACATTTAGGCACACTCCAATGATGCATTTTGACTGTTGTAGAGAGATATCTCCTGATCAAT
CGCATGCAGCCCCTGATGATCTCCGCAAGCAGACTCCACAAGCGGATCGAAAACAACCGTGAGCTGGCACCCATCGCCGTTCAGAGCGATGCAATGTAGG
TAGGAGGATGGTGTTTGTGTGGCCAGTCGGTTGATGATTTTCCAGCCAAGCGTCATTTCTGACTCAACACCCGGAGGCTGAAGCAAGATTCGCCACGAAC
TCGCATCAAAGCTGCCAGAGCTCGTAAACGGCAGCATTTCCTCCCCCTCCATGGCCCAAGTGAATGAGCTGGTGTATCTCGAAGCTGTTGTGAAGGAGGC
GATGCGCCTAAATCCTGCCGTTCCGTCCAATATCCGAGAAGCTCTTGAAGACGTTGTGCTGTGCGATGGGACTGTCGTAAAGGCCGGCGAGGCTGTGAGC
TGGTCTTCGTATTCCATGGGACGGATGCCTCACGTGTGGGGTCCCGATGCGAAGCAGTTTAAGCCGGAGCGGTGGATTGACGCCACAACCGGAAAACTTA
TGGCTGTGTCGCCCCTCAAGTTTCCCTTGTTCAACGCAGGCCCTCGCGTGTGTCTCGGAACGAAGCTCGCCATGATGGAGATCAAAATCACCACCGCTAG
CGTACTCAGCAAGTACAATCTGACCGCTGTTCCGGGACACCAAGTCACCTACAGACTCAGCTTGTCACTCGCTATGAAAGACGGATTCAAAGTCAACGTC
AGGAAGGCCACCGCAGCGTCCTTCGACGGAGTTGCCTGAGCTGGACTTACATTTCTTACTCGCTATTGTCGTTGGGGCTTCTGCTAGCTTTGTACTCGAT
TGTCGCTTCAGCTTGAAGATAGTCGTAGCAATCTAAACTTCGGTGTTGATTCACGCTTCAGCTTATTCCATGCCGGCACATAGCGCACCTCCCACACTGT
TGACGCGAGGTAATTCTGCGTATATCGACTTACTCGAACGATGAACGCTGGGAAGTTGCTAGATTCAGCCGACAACAGCTGCTTCAGCAAACTCATGATA
GTTTCGTGAAAATGTGATTGTAATTCAGGCGTACCGTCGTGGCCAGGTGGGTCGTTTTCAAGCCACGAGCAGTGTCAAGCTCAACGAAAACGAAAGATTT
GGTACGAACAGCTCTGAGTCTCGTAATGGTCCTCCCTACACATTCAGCTCGTCGGAAGCCTGCTGCTGCTTGTAGCCACGGCATCTCTCGTGTTGCTCTA
CCATCAATTGGGGGATGCGGTCTCGCTTTCGCATACGCCCTGAAGTTATCTCGAAACCGTGAGAGCCCTGCCACAGCTAGAGCCAACGATGATAAGCAGG
AGGCCCCGTCACGCCTACTACTTGACCTCCAAGTACATCCACCTTGAAGTATGACCGTCGGATGGAATTATCGATTTCAAACACGTGAGTTTTCGATAGG
TACAAGGATCGAGGCCAGTTAGTGCTGCGCGATTTGAACTTCTCCGTCCGTCTTGTTCAAAGGTACCCTGCGCAATTAGCTGGGCCCGCTTGGTCATTTT
AGCGACGCTCAACTATGGACAGGCCTGTCAGGTGGAACTTGGACCGCGGGAGATGGCAGGCTCGATGTGCTCGTAGAAGACAACGGCAAGAGCTCCAGCG
TTGGTTGAGTGACAGATGCTCTGTATGGTTTGCCCGTTGCTGCGCAAGTCGCGTATCGTGATTTTCGACGAAGTTACCGACGCTGTAGGCCACGCCACAG
ATCAAGCACTGCAAAGAGTGATCCGCGAGGTGTTCAAAACGTCCACTGCACTGTGCTCATGATCGCGCATCGACTCGACAGAATTCTCGACTCCGACCGC
AATTTGGTCGTGGACGACGGCTGCGTGAAGGAGCTAGCAACCCCCGCTGGTCTTGTCCAGAAAGGCAAGGGGTGCTTCTTCGATCTCACGGACGAGGGCG
GATACCTTGATCACTTCTCGGGGGAGCACACCGCTGGTCATACCCAACAACAACTTGCGCTGTCCTGACGTCCCTAAACGTTAACTAGCAGAGAAGCAAA
ATTGACATTTAGTTAGAGCATCTTCACTGCGGCGTACCACCTATTCGCGCAGCAAACGAGATATTCATTGCGGCTGGTATCAAACCTAAATGTATTGAAC
GCTTTTTCTTCTTCTTTCTGAGCTGGCCTCATCCGCCAAAGCGGTCCGGTAATTCACTTGCTGCTACGCCAAACCAGTGCTCTTGGTCGCCGAGTATAAC
TTCTTTAGCTCGAAATGCAACTATTTGCCACTCTGCGTTACAGGCACCAAACGTGCCAGCTTGCCGGCCTTGGCAGGATCCTTGGCGGCCTGTTCGAGGT
CACTCGGTGACCGGTCTTCTTCAATTTGGACGAAGCCCGCGCGATTCCGGGATTATTTTCCAACGTCTTGAGCGCTCCGTGTCTATTGAGCAATTTCGAA
AAGAAGCTGGGATTGTCCATCTTGGTTCCTAACTTCTGGATGGAAGGATCAGGTTAAATACTGTACATGTAGGTTCAATTCGATCGTGTTTGTGCTCTAT
CATCTTTGCTGACTCCGCCGCACCTTCGAAGAGATCGGTAGTGTCTACAGGCTGTGACGGCTTGAAAAAGGCGACGTACTTCGGCAAATCAGGAAAAGTA
CCCGCATAAATCTGCAGTTATAGCTAATGAGCAGTAAAATCTACTGTTAGGACTCACAGCTCTTACTA