Description :
From Genome Similarity Track
Location :
Scaffold_628:5064- 7400
Transcript NameFunction/comments
g9118.t1hypothetical protein

Sequence
2336 bases(100 bases per row)
GAAATCTGCGTAGTACTAACGCGGCGCATACCCTTGCAATTTATTCACGCTGTAAAAAGTTATGCTCGGTCTGCCCAGAGTTCCTCACCATAATCTTGTG
CGATTTTAAAATGTAAAGTGAACGGTCTAATCCTGCGATACCCATGCAGCACCGGCTTCTTAAGTGTCAGCCTTGTGGAAGGCACAAAAGTACTTTCATT
TGTCTGATCGAGCCTGGTGGTATCGGTCTCATCGATCGTTTACGACCTTGCCCTCATAAGCTCTTCTTATGAGGCGGATGGGCTACTCTACTTTCCTACA
GCAGACACTCGAACCACTTCACTGGCATCTTGGCATCGTTCAAGAGTGAATCGCCACTACGGAATGCTGTATCGGCGTGATTGATCCTCGGCGTGTAGAA
GCGGTCGCGATAGGTATCGCCAAACTCAGATCGCGGGATGCCTGCAGCACAGCTCTGGAACTCCACCAGGCCGTCATTCTCGTCCGATTTGTGTGGAACC
ACGTTGGCAAGTGTCCAATAAAGCGGTAGGCGAAGCGATAAGACCCCGGAGAACCCACTGCTACACATAAGGGCGTACACATTTTTCCGATAGGCCTCCT
GCGCAGCAGCGTAAGCTGTATCCAGTTCCACAGAGCCGTAACGCTCACCCTCGTACGCTAGAGATTGGATTCCGGGACCAGCAGGGCAAAAGCCTCTCAG
TTCCACGAGCTTATCCAGAATAAAATTTGTGTCACCCTTGCACGAATCCTGGAAGTAATCAGAGACCATACTTCCTTTCATTGGTGCAGCAGAACTTACC
CACGTCGAACTTGAAGCCAGGCTGCACTTGCCATTCGCGATTGCGCCGGCCATCATTAGACCGCCCATGGAGTGCGTCACAATAATCGTGTCAGAAATGG
TAGTTCCTTCGCTGGTCTCGCTCAGTCCGAGTGCTAGATCACACACTTTCTGCTGCTGCCCGTCGTCGGTCCAAGATATATTGATCGTATCGAGGACTGC
AAATTTCGTCGATGTACAGCATGGCGCGTGGTCAACCACATTACCCCAATATTTCGCGACTGCGAGTATTTTCAAGCCATGAACGAAAAGACACGGACGC
GGTGTTGACTTGCACGAACACGAGTCCTCCAACGAGAAATCGAACTCAGCTTTCAAGTTTCTCACATCTCTACCAGGAGCCATCTTACCCGTAAGCAAAG
ATCTTCCCATTGGCGATACTGCACTTGGCAACATCGTCGTCGTGCACTCTGCTGCTGTGGCACGATTCGGCGCGATAATTTCCACATGGCTGTCTAAGTA
CTCCACAGTGACATCCATGTCGCTCCCGTACATCGTGAAGCCAGACGAGCCCGAGACGCACAATCCAAAATCGAGGCCATTGACGGAAACACGAAACTTT
TGTGCACCCAAACAATCGCCAACACCACCGTAGCTCGTTGGTATACCCGACACCGCTGTGGCCTCGCTCAACACTGAGACGATCGAGTTAATCGACGGTA
GGACCGCCGAACCTACACATTTCGCCGATGGATTGCCGGTTCCAGGAGAGCTGCGCGACGCGAGCATCACACCATTTATAACGGTGTAGTTGTACAGTGT
TGGACCCGCAGCAATGGACGCAACCGAATTGTAACGCACACTAGCGACTCCACTCGTCTCATTATCGGCAAATACGACAGGGCTGGCGAGCACGGAGAAG
GTGGGACACCCGTGAACTTGCATGGCACTGCGCTTGATCGTGAAGTTAAAGCGTAGCGACGGCCATTCATTCCTTGGTGGCTGAAAGGCGCGAGGCTCCA
GTTGCTGCATTGGAGTCGCGGTTTCTTGCCGACTTGCTCCTGCTGGTATTGCGAGAGCAAACAAAGTTGCAAACAGAATAATCGAGCTTGCAAGTATAAG
TGGTGGCATCTTGCGGGTTGGGCGACGGAGGTGAAAATTGAAACTGACTGCGAACGTGATGGCTCGATTCGATATTTTTCTTGCAATCGTGTCCCAATTT
GCTTTCGTGCGCGCTTGCAACCACTTCCAGACACATTTTTGTACTCTGTCACAATTTGACGTCCCCGTGCAGAGATGGGCACCATATTCGAGCGATTCCC
CATAGGACTCAGACTTTGGAGGTTCATGTATTGTCATGACCGGCCGGAATTTCTCATTTATAATACCCTCAGACTTGGTTAAGAATTGCCCCCGGTTTAA
ACACACTGATTGGAAGAGCTCTTCATGATGCAACAACAACAACAACAACAACCGACCTCGGAATTGTATTTTCTTCAATCTCTCTTTTAGGCCTTTATTA
TTTATTATTGAACTTAACCAGTCAGTCATGTTCTGT