Description :
From Genome Similarity Track
Location :
scaffold_28:50636- 52661
Transcript NameFunction/comments
Plaha_PHALS_01605agc akt protein kinase

Sequence
2025 bases(100 bases per row)
GTAAAATTCGACGTTCAGATTTCGTATGTTCCACTTGATTTTTTGCAAACACGGAAGCTTTTTTCAACACTTTCATGGCATAAATGGCATTTGGATTCGA
TGCTCCATCGGGGACTTTCTTACGCACGAGCATCACTTTTCCAAATGCGCCTTTTCCAATGACTTTAAGCAGATCAAAGTCTTCAACACTGAGTTTTGAA
TTCTGTGGCGGTTGAGCATTCGATTCTGATCGTCCTTGATTCGACATTTGCGTATCAGATCGATTACGAGCTTGCGACATATCCGTTGACAAGTTTGTCG
CGGTGACAGcatcacttgccgttcgattAAGACGTGGATATGTTGGAAGTGGCTGCGTCGGAGCTTGATTCGTACGTGGTCCCTCAGTCGCACACTCAGT
ACATACACGTTGTGCTGTACTGGAACCCGGTAGAAATAGTCGATCTCGGGAACAAGCATTGCAAACTGCACGGTGGCACATTCGACAATGATGACGACGA
TCAAAGAGAGTAAAGTGAAAGAGACAGAGATTACAGTGTTTTTCACTATTGCCCATTTTGGAATTGTTTGCCTCTCGTCGACTTGATTCTTGACGTTGTA
ATTGAGGAACAGTAGCATTTGTACCATTCCCACCAAGTACTGGAGCTGAACTTGGTGGTTCCGATACTGGTTTTTCACCCGCGACATATGTTGTAGCATC
ACGTGTATCTAAGAATCGAAAGAGTGCATCTTGGATCTTATTGATACAAAAAGCTGTCACATAGTAATGATTCGCATGCGCGCGTGGTGGTCGACCAGCA
GATAAGCACGTACAACCAGTACGATGTGGTGCATCACCATCTAATTTTGTCTGAAACAATTGATCATTACTTTCCCAATACATTGTACGATGTGCCAAAA
TCGACTTGACAGATTGCGAATCACCATCTTCAATTCGATGACTTGATTCAATCAAAGCAATTGCACCATTTCGACGCATCAATTGATCTCCACGCGATTG
AAGAAGGTATTTAATCAATACTCCTCCATACGAGTAACCTAAGAAATACACTCGTCGTGCTCCCGATCGTGCAATGTAAGAATCCCAAAGAGAATCCATA
TGTTCTTCTGGACTTGATGAACCTGGAATTTGTACTCGTTGTTTTCCATCTCGTAGAACAATGACATTTTTATTTGGATTTGCAACAATGATACCATAAC
CTTCATCAATGGCTTTACGAAAGTATTCAAGCATACTTCCACTTTTCACACCAGCATGTAATACAAGACCACGACTCCATAAACCAGGATACAAGCCACG
ACTGACAGCTACAAAAACTAATAGTTTCTTACACGTCTCGTAATTTCGAGAAACAAAGACATTAGCTTTCACAGGGGTATCCGATGTACTGGTTGCAGGA
ATAAATGCTTCTGTAAAACTTAATTCTTTTCGCATGGAATCTTGAACATATTTGACAACAGTATTAATGATTTCATCTTGATGAACTGCCAAGTCCGAGT
CATCAAGACCTTTGCCCGTAGCTTTTAAATGAATCATTCCTTCGTTATCCATTGCATAAAGTGGATGGGAAAATGGAAGAGCAGCTGCACGTTGACTTGA
TTGTTGATAATCTGCTGATGCAGGTGCCGGAGGAACATTTCCATTTGATTGCCAAGATGGTTGTGCTTGGTAATCCGAACCGTTGCTATAGGTACGTCCA
GGTGCAGATGGTGGACCACGCGGGACACCTGAAGTACCAGTTGCTCCATTAGGATAATATTTGTTCCCAGCACCACTTGGGTCTTTGTTTTTATTCTTCT
TTCGTCCCCATCGTGGAAATCGGAACGACATAATTGAGACTATCACTTAACCAATTAGTATAgaagagaaaaagaaaaggaaAGAAGGAGATGACGGTAC
CTTGTTAGTAGAGGAATTATCGATTGCAAGCTACGACACAAGACACGACAAATAGAAACGTCAGATTGCTTACTCCACGTATGTCGTTTCTACTTTCGTG
AATGTTTTCTCTTTCAAGAGTACAT