Description :
From Genome Similarity Track
Location :
Scaffold_19:50610- 52155
Transcript NameFunction/comments
Phyag_g559myb-like DNA-binding protein, putative

Sequence
1545 bases(100 bases per row)
TCAACCATGGGCTATGgtcgccatcttcattgCGCTCGACACATCAACTCGGGTCAGGCAGCTCTCGGCTTGCCCACGCGAAGATGGAAGCAACTATACG
TTAATCCCCACAAGGTCTGCTTGTCCTTCCTCCACACGATTGCAGCACTGACCCGCCGGACTTCTgcatgaagatggcgaggaGGCAactgtcctcctcc
acgacagcgctgctgtcaacgacgaaggtgctggtgttggtggtggcgaaggcgtcgacgactGCCGCAGATCCCTTCGAGCGCACTCAACCTTGAAAAT
TGGCAACAATGGCGGTAGGTAACAGAGCCGGGCCATGAAGGGATTGTTTACTGACCAGAGAGCTTCTGCCGCCATTGATAGGACGTGCCGACCTCCATCG
TGGTTGTAGCAGAACGGATCGCCGCCGCGCTGTCATTCTCAAATCCGCTTCACATCGAGCGAGTGCCAAGCCAAGCGAAACAATTCGTCACCACCATGCA
catggttgctgctggagcaagTTCGCCCGTGTCGGCTACCAAGACCAAGGCCAAGTCCATTTCGCCGCCGGCCAAGGGCATTTGGTCTCTGGAGGAGCAC
GACCGATTCCTGGAGGCCATGAAGCTCTACCCCAAGGGCCCATGGAAGACCATCGCCGACCACATTGCTACGCGGTCAGTGCGTCAGGTGCAGACCCACG
CGCAAAAGTATCAGGAGAAGGTGTCGCGCCGACTACGCGGCCTGCGCAAGTCTAAGAAGAAACTTGTGCGTCCTGAGCACCGAATCGACGAGGACACCAT
GGAGCTGTGTAAATTGGTGGACTGCGCTGCCGAGAAGCTGGTGGCATCAAGTAAAAAATCCTGTTCACGAAAGAGTGGTGTCAAGCTGGagccgctgcag
aagcagaaaaagaccgtcgtgaagcaggagcCCGTCGAGGCTCACAGTAGCCCGCGTGGTACAGAtgtggagatgaagacggacgaCTTTCTACCGCTGC
CGTTCCTAGACTTTGGCGATGACATCGACATGGACCCTGCCCACATCCCCACCGTGAGCGAGTCACTAGACTTCCTGATCGACTACCTGTCGTTATAATC
GTGCATCGGTTGGTATTAGCGCAGTAGCGATGGGATCGACCCGTCATATTTGGTGAGGTATCCGTGATCAAGCACGCctctggaggaggtggtgactTCA
TATTTATATCATAAAGAGCCTTTGCAATAAAAGCCTTATCGGTGGGGGTTGATGGTGTCGATGGAGCAACGAATCGCAGCTTCCCGACCTAACAGCCCCC
GCTAGATCCTTCGACAACAGCGTCCCCATCCACGGACTAGGGTGGCATTTGCTTGCCAGTGCTGTCAAGTTGAGGCAGGCTCGCGTGCTGGTCCTCATGT
TGCATCGCAATGAAGTGCCACCACTGTCACGGCGCTACAACGAGCAGAGACAAAACAGTTCATTCCTGCAAGCCAAGTGACTTCCCGACGAAGCTCGTCT
GGCTCAAGAGCTGGGAAGCCACTGGGAGATGCAATTTGGCGCTGG