Description :
From Genome Similarity Track
Location :
Scaffold_389:5061- 8005
Sequence
2944 bases(100 bases per row)
TTAACAGATAGCAGCTCCTTGATCAGGTCGTTCAACTGTTCTTAAAATTGAGGGGCCACTTTCCGTACACGTTGCGCGATCCGCTTTACATTTACTACAT
CATTGTCACATATAGCCCCTCGAGCGGCTGGCGGTTAGGCTTTCCCTTTCCCCATCAACAGATGTCGTCTTTTCCAGATGATTTGTCGTAGCCAGTCTAC
CTCTTCTGGAGTGTTCCCATCCGGATCAGGAATCTGTATGTCTTTTAACCGGATAGTTTCAGAGGAAAGGTCCACTTCCGGTATGATTGCCCACCCTCGG
TTTATGTCTTTGGCCCACAGGTCTCCACTATCGAATGTACACACTTATTCATCGTCCCGTGGCGATTCGTTGGCCTCGGCTTCCTCTTCCTCTTCTTCGA
CTACGACCTCTACCGGTGGATTGTCTTTGGGACCACTTCTTTCTTGAGGGGTTTCTTCTCGTTGAGGCACCTCTTCTCCACGTGACTGTTTTTTTCTCTC
TGATAGCGGCTGGTATGACAGATTCATCATTGACCCTGGGGTCTTCGAACGCTGGAAACTATGCAACGGGATCTTGTACTTCGGGGTCTCCACTAGTGGT
GCCTCGTCTTCCTACTCGAGGTCAACTTGGGGTCGACCTGGTCGGTGGGGGCTTCGTACGCCAGATTCGCCACTCAGCGTACCTTCGAGAGCCTATAGAC
GAACCCTTGTGCTCTTGGTACTTGACCCTTCGTCAGCCACATACCTATCATGGTATCATTATGTAATCAACGTGTGGGGCTGACGTTGGTCACATATAAT
AATTGTCAGCGTCCTGTTCTCTGGATCATAGTTGTAATCAATCGCTCTCCCCTTGTGAACCATATCTTCCATTGATCTGAGATCGACTTTTCAAGAGGTA
TCTCCACACATCCACCAGCAAGTATACGGGCATATTATCCTAACTTCACGTCTGAGACTCGGTTATCATAAACGTCCCTCTGTCCGGAGAGTTATGTCCG
GACTTCGTCAGGGAGACAGAGTGTTCCATCCGCCAGATCTATCGGGATACCAGCCGGTACCATGAAGTCCATTCCTAAGATCGCATCCTGAACCACCATA
GGGCCTATCCACACCTTGATAATGTACACTAAATTGCCGCTTAGGGTGACCTTGATGCGACGGTGCCCTTACGTAGAGTACACCGATTCCCCAAAGCCAA
TGCAATTTTGCCCTTCGCTTTTGTCAATTTGGCAGCCTACCTTACGAGCACAGGCGACATTTAAAATGGATATCACGGCGCCAGTATTAAACAAAAACAT
TGCGCGATCGTTGATAGTCTTCACAGAGAGTTTGGCTTGTTTATATAACGTAGTGGGGGCACGATACCCTCTGAAATCGCCAGGTAGTAGTTCTAACTCC
GTCACTGCATTTTCTTGATCGAAATCATAGGTTCAGTGGGAGAGACAACATGGTCCATGGGATAGTTTCCAATCTTCGAAATATTTTCGGTCTTCTCAGT
GGTAAACCCCCTCTCCCCTTTTGGCTGCTTTCCAAATATGCAAAGACACAAAAACTAGAACGGTCGACTCGTACCAGATTCAAACCTGGAGTATTCCAAT
TTATCATCTTCTCAACTTTCTCCGGCAACATTCCGTCGTGCTTGGTGGGGCTGTACTATTATAGAATCAATTTGTAGAAGTCCTATAGCTGGCACTTCCC
CACTACATGGGTCTCTCCGCATCCCCGACACACGAGCAAGCAGCGATCTGATGGGTGCCCCTTCTTCCCCCAGTGGTCACAGGTCATTCTCTTCCAGCAC
CTCAAGTCTCCATGTTTCCTGGACCACAGTGGGTACATCTTACGTTTAATTTGGCCGACGTATTGCGGATTCCAGGGTATCCCACTTGTTTCCGATGCTG
GTCGACCTCTCTGGTGGCTTGGTATCTCATGGTCCTTGTATTTTGGTCTCTTTCCGCTTCCGCTAAAAAAAATTCACCTCCGGCCTCCCTCGTTATCTGA
ATTATCCAGGCTGGATCTCTCCGAACTCGACTTTTCTAGGGTTGCTTGGACCACACGCAGAACGGCGGCTTATATCTCTAGGTCGATCCGGAGGAGCTGA
CACCTTCTACCAGAACTTGCTGGAATCAAAAAGCGTCTTGCCACGCCGTGTCTTCGACTTGTGGTGCGCCTTCAATACTTCCTTCAACTCTTCCATTCTG
ACAGACGTAGCATCGTCAGTTTTTTTGGCAACTCTAGGTCGTCCACGGTCTCGATGTAATGCTCGATATGTTCCTTCTGGATCTTGGGTGATACATTCTT
GATCTCCATCTTCTCCCTGCGAGCAATCACGTTCAGGCGGTATCGGTAGTCATACGGGGATTCGTCTGACCTCTTCTTCGCGTGGTAGTGCTGGCGGGCA
ACTGGTACCCACAGGCCACAGAACTGCATCTGGATTTCTTGTATCAAGTCCTTCCAATTTTCTCTAACGAAGCGGCCCAATGACGATACCAGTTCTGCGC
CGGTCCGATCAGCCCTTCAAAGACAAGACACTTTTCGCTTTCCGGTGCTTAGGCCCTTGCGAGGCCGTCTTCACTGTCGTCACCCAACTGCGTGCCCCGT
CCTTGTCTAGGTATCGACCATTGAACTCTTTGAGGTCCGAAGTTGCAGAAGGCTTGATGCGAGGGACCATGTTGAATACCTTTCCCATTGCGGCATTGGC
CATCCTCGCTGGGATTCCACCAGATCCAGGTCGTCCAGGTCGTATTCGCGCGATCCAACCGATTCCATTTCGACGTCCGACATTATGAGTTGTATTTGAG
CTTGGACCTCTTTACTCGGACCGCTTCTAGTGTTCGCCAGTCGCGATTCCTGTCTGCCTCTGGTCTCTCCTCGGTTAGGGCGTGTTGATGGCACTTGGCG
TTCTTGGAAAAACCTTGCCATCGCCGCGTCGAAGTATGCTTGCA