Description :
From Genome Similarity Track
Location :
Scaffold_121:50604- 56222
Transcript NameFunction/comments
Phyci_240925Hypothetical protein
Phyci_240946predicted protein
Phyci_320491conserved hypothetical protein

Sequence
5618 bases(100 bases per row)
CCGACCATGAGCGACCCCGTGCGCGACCAGCGCTTCCAGAAAGTGCACAATGACCCGGTAAGTAGCGCCGCAACGCCTCCAATGCAGCCACGCAATTGGC
TCTCTCGCTAACGCAGAGCACTTCGAATGCAACAGAGATTCGCGCGCAACTCGAAGCGCAAGAGCAAGCTGCAGATCGACCGGCGCTTCGCCGCGGCGCT
CAAGGACGAGCGCTTCCAGAGCGTGCAGGGCAAGTACGACAAGTACGGCCGGCGCATCGAGAAGAAGGACAACGAGCTGAAGAAGTTCTACCGCCTggag
gaagacgaggacgacgaggagcagcaagaggaggaggaagaggagcaggaagaggCCAAGGCCGCGTCCACGACGAGCTCCGACGACGACAATGACgacg
ccgacgccaccgtcgccaagaacaacgaGAAGCTCTCGCGACTCGACTACCTGAACCGCATGGCGCGCGGTGAGCTCGAGTCGGGCTCGGACAGCTCCGA
CTCGGACTCGGAGGACAGCGACGACGAGGAAGTTGCTGCTGCCGAGAAGGAAGAGGAGGAGGACATCCCCATGGGCGAGGAGACCAAGCGCTTCGCTGTG
CTCAACTGCGACTGGACGCGTATCCGCGCCGTGGACCTGTTCGCGCTTTGCCAGTCGTTCGCGCCTCCCACGGGCGCGGTGCAGAACGTGACTATTTATC
CGTCGGACTACGGTCTTCAGAAGATGGTGCGCGTGTGCATTGGTTTGTTTGGAGTGCTGATGAATTCGTGCTGACGGTTGCGCTGTTTGCGATGTGGTTG
CAGAAAGAGGAAGAGCAGCACGGACCGCAGGGTCTGTGggacgacgaggaggccaagaaggcgcaggacgaacagccggaggaggccgatgaggaggagg
ctgaaagtactggtgatgaacaggacgaggaggagaaggCTGCCAAGGCTGATGGTGACAACGAGGACAGCGACGCGGAAGGCGAAGAGGACTACGACTC
AGATGACCCGCTCGGCGTGAAGAAGAGCGTGACTCTGGAGGGCGAATCAGACGGCTTCGATCGCGAAAAGCTGCGCAAGTACGAGCTGCAGAAGCTGCGC
TATTACTACGCTGTGGTGACATGCGACTCGGTGAAGACGGCCAGCACGATTTTCGACCAGTGCGACCAACTCGAGTACGAAACATCATCGAACGTTCTCG
ACCTTCGCTACGTGCCGGACGACACTACCTTCGCTAACACGCCCAAGGAGTCGTGCGATAGCGTTCCCGATCGGTACAAGCCGGCCATCTTCGCCACGCT
GGCGCTGCAGCAGACTGATGTGAAACTCACGTGGGAGGAGGACGACGAGCAGCGTCTTGAACTTCTGACGCGTCCTGCTGACTGGAAGGATGCCCACGAC
GATGACTTTAAGGCATACCTTGCGTCGGACGTGTCGGATGCTTCCGAAGCTGAGGACGATAGCGACGATAGTGATGCGGATGAAGACGCTGAAGGGGAGG
CGGATGCTGCGGCCCCGGGCAGCAAGAAAAAGGCTAAGAAGGAGGCCAAGATCAAAAAGCTGCGCACCCGTTACCGATCGATGCTGCTTGGCAGCGATGC
GGAGGATGAAGACGATGACAATGTCCCTGAGGGAGGCTTGGGAGCAAGCAGCGATGAGGAAGAGGGTGGAGAAGGTGACATGGAGATGTCGTTCACGCCC
GGCGCTGGCGACGTGCTGAAGGCGAAGAAGCAGAGGGAGCTCGAAGAGAATGAGACGCCGTTCGAGCGCTACACGCGTGAGAAGAAGCAGGAGAAGAACC
GCAAACTGCACGAGAAACGTGCGCGTCAGAAGCAGCTTGAGCGCGAGCAGCGCGAGGTGCTGAAGAAGAAGGGTCGTGGCGCCAAGGAGGCGAATCTCTT
GCGTGAGGCCATCGCTGGTGGCGGTGATAGCAGCGACGGTGGCAACAGCGACAGCGACCAGGACGAGCGCAACTACGACATGAAGAAAATCGCCAAGCAG
GAGAAGGTTAAGTCTCTGAAGGGCAAGCGCCGCGCCAAGGAGATGAAGAAGCTGGCCAAGCAGAAGGCGGGCGGCGGTCTGCAGGAGGGCTTCGAGTTCG
ACGCGGCCGACCCGCGTTTCGGCGCGCTGTACGCCAAGGGCTCGCACTTCCAGCTGGACCCGACGGACCCCAAGTTCAAGAAGACGGAGGCCACACAGGC
CATCTTCAAGGAGCGGCGGCAACGGTACGACCAGGACGCAGCTTCCGCCGCGCAGGCCAAGCCTGTCAAGTCGGACTCGGTCTCTGCCAGCAACGACAAC
GGAAAGCACACGCTGAACACCATGGTCGAGAACCTGAAGCGGAAGTCGCAGCAGCAACAGCAGGACAAGAAGAAGGCCAAGAAGCAGAAGAAGAGCAAGG
CATAAGCGACGATGAATCGTAGAGCCGCAGAGCGATGCAGGATGGTCCAAAGAAGAACAAGTTTTGCTTTGTCGTTGCTGGTCTACCGTTTCGATCGTGT
CTGGATGAGGAGTCACATTCGCTGATCGCCGTCTGAAGCAGCACTATGCAGGTACGAGGAGGTTTTGGCTGCCTTGTCACGCGCGGTGTAGCTCACTGGC
GGTGTCATCGTCTCTTGAGCAGCGCGTTCAGATCCAGGAGGTGCTACCGAAGGCCGGGCTCGTGTACTCGGAGCGCGGCAACTTGACCGAGGTGCTCTGC
AAGCCCAAGATCATGCCCATCAAGTCAGCGACGCTGCTGCGCATCGAGGAAATCGAGAAGCAGGCGCGTGCGCTCGCCAAGCCAGCTACTGCCAACTCGC
CCGACTATGATCGCCCTGGTACATCGAGGAAGTGATGTCTCTGAAGGCAGAGACCCACATCACATAGTCTTGTTGTTGCTCAAGGACAAGTCCTGTCGAA
GTCGGACTTGTGCGACGACTAAGTTAGGTAGCAAACACAATGATGTTATACTCTATTTGCCACCTTCACCACATCTAGCAGAGCAAGTCGCGGCGTTTAT
TCACTGAAAATCAAAAGTCGTTGACAATACTCGTTGACAGCACACCGTCCTGTTCATTACTACCAAGTGAACATTCTATGACTTGCAGCGTCCTACTGCA
TGCCACCCGAAAACATCTCGAGAAGAGAGCTGAGTCCCGATCGCGGCGGCTGGAGTCCGTAGAACTTCTGGCCGATCACGCTTAAATACTGTATTGACAA
CGAAAACCATCAGCCCCACCATTTCCTCGAGACCTCCATACAACTCGGGCAATACGTACGCTCTTGAGACTGCTGTCACGAGCAAGTGCCGGAGCGTAGC
GTTCCTGGAGCATCTGGAAGAGAGGCAGTGCATCGCGCTAGCAATAACAGCAACCAACAGCAACAACAGCAAGCGAACGTAACGTTATTCATCATGCCAC
ATTCAAAACAATCCATCACGTCCTCACCTCCAGCGTCAGCAGCAAGAAGCGCGTAAAGTTGAACAGCGGCAGGTCAACGGGGCGGCCGGCGCTCTGGCAC
TTGGCGACGTACACCTCGTGCACCTTGTTGGCGTCGCGCAGGTTCTCCAGACTCAGCAGCCTGCACACAAAAAACACACACAAAAACTTAATCAGGCCAC
CTCCCCACCCACCACACCCTCCTCCCAACTCCTTACTGCAGCACGGCGCGGGCCAGGTACAGGTCAGATTCACTGGGGTATCCCTGCGTCGACCACTGGA
ACAGCGTGTCCGCCAGCTCCTGCGGGCTCTCGGCGTGCAGGAAGTGCTTCATGGCGTGCGAGAAGTCGCCCGCCGTGCGGTAGGCGCGCGCCAGCAGCAG
CTGCAGCTCCGGGTCGCCGCGCTTGCGGGCGCCCTCGGCCGCCGACCACTTGACGGCGTTCTTGAGCACGGCCGCCAGGTCGGCGCTGAACTGCGGCTTG
GGCTCGAAGGCGGCGGCCACGAGGCGCACGCGCTGCTTGTGCGCGTCGTCCACGGGCTGGTGGAAGTCCGCGAAGACCGAGAGTATGAGGTTGGCCATCT
CGGCCGCCGCCGTGTTCTGGTCGTGCGCCACGAGCGTGAGCGCCGCGTCCTGCGCCAGCGCCGCCGCCTTCTCCTGCTGCTCGGCGCTGGGCTCGTCCCC
CTTGAGCAGGCGCATGAACAGCGTCTTGTACATCTGCAGCGCGCCGTAGAAGTCGCCCGCCGCCAGCTGCAGCTCCAGCTTCTTGCCCACGTTCTCCAcg
cccgcgccctcggcgctcgggccggcgggggccgccgTCTTGGCGCCCGCGGCCTTGCGGGCCAACGCTCGGCGGTTCATCGCGATGGATACGTGGTCGC
TTGAGTTGTAGTGGTTTTTGGAGACCGTTTCTGGAAATGGTCCTTGAAATTGGGAAAATATACACGTAGAGAATACAGTAGCTTCGTGGAAAATACAAGA
ACACGAGTCTGCACAACCACAGCCCAAGACTCGTCGACCTCAGTACAAACAGCCCCCCACAGACAGATCCCGCTCGACGAAGTCATATTGATCAGCAGAA
GCAAATGCTGCTACAGCTGCAATGTGCGCTGACGAAAGGAAGACAGCTGAAGGAGGCGCCGTATGCTGCCCACGATGTGCGTCGTGATCAGTGAGACGAG
GTAAGACTGCAATAAAGTGGGTCGAGGTTAACACAGCGCGTAAGTTGCATCCGACCTTAACAGTCGGATGCAACTTCAAGTTTTCTGGCATTAATCTAAG
ACCGACGAGGTCAAGTTGGTGGCCGCATGGTGCGTCCGCTTCCCTGCAGTTGCAGTAAGCCCAGCCGCGTTTACGGCCCTGAATAGTCCATCCCATAGTG
AGGCTGTGCAGCTTTATGATGATTCTGAGTTGGCTGTGCAGTTTGCCTACGCAAATGCCAAGCGACGCAGCTGAAGTCGAGGCCACGTCAGTTGAGCAGG
ACTTAACTTGATGATGTTCGGCGCTGGCATGAAGCTGCAACAACTGAACATTATTTCATGAGCGGAGAGTGTACTGCCTAGCTGCCGTAAACGCGAGCCT
GGAAATATTGGTCAGTCCGCGCCATCCATACATGTATACATGTAGGGGTACTCATTCGGCTGCATCGCTGCGTTGCGCGGTTGAGTCGGGCAATTGTGAA
TCACCGAGCAGATGCCCGCCCAGGCCTAGCCTCAGCTGCAGGCTACCTACTTGGTCGTGCTTTACCGCTGTCGACTGGTCTATCGCCGCGCGCTAAAGCT
GCCTGACCAATGCTTCTCGCCACTTTTAACCGGCTAGCTGCAGGCTGGCGGGTACCTTTGGCGCCTGGGCGAATAAGTCGGCGGCCAGCGGTCACATTCT
ATGCCGAGCGACTTGATTGACGGTCACGAGTTGAAGTGGAAGTTGCCTTTTATCTGGACAAGTCGCCGATTCTCCGCCGCGTAGCCTGGTCGCGCGGCAG
CTGGCGGCACACGCGATGAGGATCTGCTGCGGCTTCCTGCCTGCTTTCTTTCTCTCGTGTCGGCGCGGACTTGAGTCAATCGGCGACTCGCTCGCGTCGG
AGCATCACCTGGCTAAGCTCCGATTTATGCGCGAGGAGGCATGTCCACACCGAGAGCAACCGCTCCTGACCCACAACATCGGAACGGCTCGGAATCCGCG
TCACACTCGAAACGGATC