Description :
From Genome Similarity Track
Location :
Scaffold_1233:506- 3826
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1233-fgenesh-gene-0.0Phospholipid-transporting ATPase

Sequence
3320 bases(100 bases per row)
GCTGAACGCAGTATGGGGTTGCGAGTCGACTACGGGAGTCGACTGCAAGGAGGAGAACGCGATGTGAGTGGAGTCCCAACTGCCTGTACATTGCTTGATC
TTTGCGTGTCCTGGGAGCATCTACTTCACAAACTACAGTGTCGCCTGGCGACGCAAGTCGCGGCTCGAGGCGGACGTCGAGAACCGGCGCACGCGCGTCG
GACCGCCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTGGGTGCGAACGGGTGCAGCAGCCTCTGCAGTAGCGAACGCGGTTCCTGGTTGCG
GCCCGTGCGACTCAGCCGACCGCTCGAGTCCTCGCGCGGCGTGCGGCCAGCGCTGATCAGACTGGCGCGCGGACCGCTCCGACCGCTGTCCTGACGCCGG
AAGAAACGCCGACGCCGCTTGTGGCCCTTGGAGTGGCGAGCGGCACGGAACAGGTTCCCCATGGAGCTCTTGCGAGGACGCGTCTCACGCTGGTGGTCGT
CCGTCGCCAGGTCAGGCTGTGCCGTGGCCGCACGCTCGCGCCGAGGCTGCGGCCGCGCCATGGCGAGTCCGAGCGCCATGTCTGGCGCTAATGCCGCGGC
CGTGGCGATTGTCGCATTGGTGTCACGACGCTCGGGCAACGAGTGGAACGCCATGGAGCCGCGACTCGCGTGCCGATCAAAGAGCGAGCGGAAGACCTGC
GTGTCGCTGCGGAAGCGCTCGGACGCGATGAACGACTCGACCATGACGGACTCGGCGTCGTAACTGAAGGCGGCGCCACGCGACGGCCGTCGGCTGCTCC
CGATCCGTGCGATTCCGCGCCGCGGATGGCCTGGTGTCGTCGGCTGAGACGGGCCTGGAGGAGGCAACGACGGTGGAGCAAGCGTGGCCTTGGAGATCGG
CTCGGCGATGCTTGATGACGACACGGCAGGAACCCGCGACACCAGGTACGAAGACTCGACGTCGGTGGGGATCCGCTCGGGAGGCGGGAAAGCGAGCAGC
TGGTCGGCGATGCGCGCGAGTCCGAAGGAATGCACCTCCTGCGCCAAGTGCTTGTACGACGGACAGAAGGCACGCACATACCCCTTGGTCAAGAAGTCCC
GCGACAGCGCCACGGACACGAGCAACGGCACAATGAGCCAGAAGGCACCAGTCCCGAACGTGTTGGAGAAGACGCCGTTCCAGTAGGCGGAGCTGACCGA
TTTGCCGTGCGAGATGAAGGCCGCCGTGCCGAGCCATGCCGAGAACGAGACCACGTAGACCGTGAAGTGCACCGGACGCCACCACATTTGCTGGTGCAGC
GCCAGCTTCAACGACACCACGAGCAGCACGATCGTGAAGGCGGCGGCACCGTCGACCCACATGGTGGGCGTGTCGCCGTGACCCGCGAGGTACCGCAGTC
CGTAGAGGGTGCCGAAGCAGATAACGAGTGACTCCCAGACGCACGACATGATCCACGACCACACGACCTTGGTGTTGAAGTGCCGGTTCTCCTGTCCAAT
GCGGTACAGCAGCGGGAAGTCCTGCGCCAGGTACGCCGGCACGTCCTGCTCGAAAGTCGCGACGAGCACGATCGGCAACGCTGTGAAGAGCAAGTTGTAC
CCCTGCAGTCCCCACTCGAGGAAGAACTTCTGACCCGAGAACCCGACGTACGTCATGTACCAGAACTGCGTCAGGTTCAGGATCACGTTCTTGTAGAAGA
TATACAGGATGAGCTTCCCCATGCGCACGTAGTTCCAGCGGCCGTGCACGAACAGCAGCCGCGCCAAGAAACGGAACTGCGCGATCGAGTAGTCGGACGA
GTTCGCAGCCTGCATACCCTCGAGACCCGAGATGCCCACTCCCACGTGCGCTGCCTGGATCATCGAAACATCATTGGCGCCGTCGCCGATCGCCAGCGTG
CGGACTTCGGGCTTGTTCTCGCGCACGAGTCGCACGAGCTGTGCCTTCTGTGCAGGCGACACACGACACGCGATCACGGCCACGCACTTCTCGGCCACTC
GCAGCAGCAGCTCTGGACACTCGTCCAGCGCCAGCTCGAGTGTCTCGCCGTCGATCACAAGCGCCAGGTCCTGCTCCAGCATGGTCGCCATACTCTCGAT
GCGGGTCAGCCGCTGTCGTGGATCCATAGCCCCACTGTCACCCGACGATGCCGCTGTGCTTGTCGCTGGGGTTACGCCGGAGGTCGCTCCGCTCTCTTCA
GTGCAGTGCTCGCGCGCGCACGACTCCAACTCGTCAACGATCGACGATAAATCCGGGTGTGTGTCAGCCGAGATCACCAGCCGCTCTATGTCAGACGAAA
GCAGTCGGCACGCAAACCCAATGTTGATGGCCGTCTCCTCCTTGTCGCCCGTGAGCATCCACACCTTGATAGACGCCTGACGCAGCTTGAAAATCGTGTC
GGGAACCTCGTTCTGCAGTCGGTCCTCGATCGCCGTCGCGCCAAGCACTTCCAAATTCACCTCGATCTCCTCCATCAACCGGTCTATGTCATTGTCCTCG
CCGTCACGGCGCAGCGCGATCTGACGCATGTCGTTGATGGCCGTGCGATACCGTATCACCCACGACTCGAAGAACGTAGGATCCAGATCCGCCCACCCGA
TCACGAGCGTCCGCAGACCTTCATTCGCGAATTGCTCCATGTGCTGGAGCGTCAGGTTGCGCGTTCGCAGCGCTGCCGGGTCCGTCGTCTTGCGCAGTCG
CTCGTACATGACCGTGTCAGCACCCTTGCAAAGCAGCTTGAGCGCTCCATCCGGCGCTCGAACAACCACCGACATGCGCTTCCGTGTACTGTTGAACTCG
AGGACTTCAAGCACTTGGTACGCGCAGACTTGGTTCGTAGGGTCGGGCTGTGGGTTAATCATGCACTCGGGACGATCGGTGCTCGAGAAGAACTCAACCA
TCGCCTTTCCTGGAGCACGTGCCACAAACTTGAACCCAAAGCACGCCGCAGCTGCCACGAGCGCTTGCTCATCTGGTGACGACGCACTCAACCGCAGACT
TCCATCGGCGGCGCGCTCGGGCATCACGGTGTGGCACACCGCCAAGTGCTCGAAGAAACGGGTGATCATCTCGGCTTGGTGCGTCGTCTTGTGGGACAGA
GCCTCAAAGATCGTGTCGTCCTGGTAGTTGACATATGGCGCCTTGATAACCCTGTCGCTAGGAGCATCCGTCGGAACAGAATCTTTGATGCTCGGAGTCG
TCACGGTCGCGGCATGAAACGACGTAGTGAGCCCTCCACCTTCCTCTTCTTGGCGACGCTTGGCAGCTATCCCCACCTCAGTCTCGCCGAGACCGTACGC
CACGCCGTTGATCGAGCACT