Description :
From Genome Similarity Track
Location :
Scaffold_233:506- 2325
Transcript NameFunction/comments
Physo_109667copia-type polyprotein
Physo_144666hypothetical protein

Sequence
1819 bases(100 bases per row)
AGTGAACCACGGTCGCGCCAAGCACATCGACATCAAGTACCACCACATCCGCGATGAAGTCAAGCGCGGCGAAGTCAAGCTCCAGTACTGCGAGACTTTT
GTGATGCTAGCGGACATCATGACAAAGGCGCTTGCGGGACCACGCCACACGGATCTGACGGTGGCTCTCGGCATTCGTGGGACTTCGCATTGAGGGGGCG
TATTGAGGGTTGCTGGTCTTGCTCTGAGGCCACTTGGGTCACTATCCAGGGGAGTGACCGATGTAGCCATCCCGGAATAGTGACAGGGCCACTATTCCAT
GTAACCCTGTTATAGTGTTCGACAGTAGGACACTCTAAACGGTTTAGTAAGGTATTGGTGTGCGTCTCGCACTTTGGTTTGGACCCGCAGACTAGCTGCG
GCAGGAGATCTCCAGTGGATCTCGTACATATTGTACAACAAGTTGTCGTACAGTGGGAAGAGTACCTCGCTGTACAAGTGCATCCGCGACAGAGTTAACC
TAAGTCTCTGCCTGCGAGTGTAAGGAACCCCATATTCACCCCTTCATATTACACGTCTTCTAGGAATTACGCTAGATAAAGATCCGAGTCTTGCTACAAG
GGTACACAAGGTGAGGCCTAGAGATCTCGGGACTAGTTCTAGTTGTCTTTGGGTATTTGGCTTGCAGGGGTAACCCCCCGTAGTTGCGTGGAAGGACACG
TGTGGGAGTTTATTAGTTTTTATCTGAGGGACTCCACCACAACGGTGCGCGTGCCCGGATCTACTAGTCCGAAAGGGGACGTGAAGGTGAAGGTTGAGGT
GAGGGAAGACGGAACTCCGCTGGGACCGGCGGAAGTTAAACGTGAAAACACTAGGTCCACCGACGGACAGGCAATGGGGACGCCTGAGCCGAAGGATTTC
GTTTACGAAGAGAAGTTCCCCGTTAAGGCTCCGAAAGGAGCCGTCCGGGACTCGGTCCAAAAACCGAGTTCCATTGGACCTGCTGCAAAGCGGGACCCCG
GCGTCGCTGAAAAGCGAGGTCGAAACCTGGAGCGCGAGCATCTGAAGGGGGTCATCCCCGACCTCGCTGCCCGAAGCGATGCTCTAGACGCTGCGATGGA
CTACATGGAAGTCGAAGATGCGAAGAAGAAAGCCGAGAAGAAAACGGAGAAATTGGAGATCTCGGCGCTAGCGGTCCATGGCCCCAGCAACGACACTCAC
GATGAAGACAAACGATTTCGTGAAGCCGAAGTCAACTACTTCCGTCAAGAGCTTGCGTTCCTGCTCCAGAGAGATCCACTCCTGCGTAAGTTGGGGCTGA
GGATGCCATGGCCTCTCACGGGTCCAGTTCGCAACCCGCGCACGCTAACAATCCGAGATCCGCTTCACGCCGTCACGATGCTGTTCTGCGTGCTCGAAGA
TGCTGGTTTCAAGGTACATGAACAGCGGATCTCCACCGATGTACGCGAGTACGATCTGGAAACCACCGTCCTTACGCTCGCGCGGGTGTACGCAGTGTTG
CAGAAGCTCGTCCCGAGTGCAGATGACTCATCCGCGCAGTTGCCGACCGGAGACCTCACACCTCCTCGGTTGGACGATTCACGGATCTCCTTCAAGTTTA
AAGATGACGGTGACGCTCTCATGAGGAGCACTACCTCAACCAAGAAGCTTCCACCGGCCCCACGTGTGTTCCGCCGAGAACGACGTGCGCAAGGGATTCC
AGCGATCACTGCAAACGATGTAGGACGCGGGAAGTCTGCGCAAGTGTCAAATATTGCGCAGACTCGCCCAGCGAGAGGACCACATGGGAGGATCCAGGAG
GCTCAAGAGGTTGCAACAG