Description :
From Genome Similarity Track
Location :
Scaffold_1911:506- 2325
Sequence
1819 bases(100 bases per row)
TATTTTAGCCAATGAGCGACATGCATAGCATTGGAATTTTGCCAACCAGCCGTTGGCAGATTCCTATGATAGAATATTACATTTAGAGGAAGTCAGAAAC
ATAAAACAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAA
TTTTAACTACGCTACGCTTCCTCACACACGTGCGCGCACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCG
TCGAACGACCGACTACCTGAGTTCGTACGTCACCGCACGAACGCGGAGCTGAGAACCTTCCATGGATACAGAAGTGCCCATGGAAAGCTCCACTACGCCT
GCAACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGATCCAGAGTGGGAGGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTA
CGATGCTGCGTACGCTAACGCCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCGACGCGATGTTGCTGCTACTACCGCGGTGTCGAC
CGGGACGACACCACGCGCGCAATCGCTAAAGCTCAGTATGAGTAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACT
GCCATTGCGGCTCGACGTATCATCGACACGTTGTCGAAGGTCGCGTTCGCCATGTCATGTCTTGGCGGATGTGCTAGAAGTTGGGCGTATGGACGCCGAC
TCTCGGGTCCTACGTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTTTGAGCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTC
CTCGACCTGCAGCAGGGCAAGCATAATGTCCATGCCTACGCTCAGGGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCC
AGGTCGTCACGTTCATGAAGGGGCTGAGAGATGGACCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAAT
GCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCTGCATGACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACC
TCTCGAGTGCTGCAACTGCTGGACCCCAGCAGTCGCAGGGAAACAATGCGCGATGCTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGC
CCCCGTGCACCAGCAGGGTGGCTATCGCGGCGGTGCCGGGTACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTA
ATGCAGTTCCGCGTGTCGACCTTGGACACGCGGTACTGAGGACTGCAGCCCCCAGTGAGGTTCATCCTCACTGCAAGAACCAAGATGACAAGCCTGACCT
TGCCATCCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGGAGAACTTTGTTCGACTGCGAAGTCTATCA
AGGCTTGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGC
GCTTCACGTATGAAGATCAAGAGTGTTGTCAAGACTGATGTGACGACGCCCCGCCAAGCGACCGTGTGACGTGAACGCGTCATCAGTGAGGTCGGCGTGA
CCTTCACTGTGTGGTACCG