Description :
From Genome Similarity Track
Location :
Scaffold_835:5059- 6115
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_835-snap-gene-0.4Glutathione S-transferase

Sequence
1056 bases(100 bases per row)
CCGTCGCTCAAACTCACGTACTTCGACTTTAAGGGCCGTGCCGAGGCCACGCGACTCGTGTTCTTCATCGCTGACATTCCGTTTATCGATGACCGCCTCA
CTCCCACGCGTTTTGCAGAGCTCAAGCACTCGTTCCCGTACGGAATGGTACCCGTACTCGAAGTTGATGGGgAAGTGATCGCGGAATCGCGCGGTATTCT
TCGGTACGCAAGTCGTCTGGCCAACATGTACCCcGCAAACGACCCTGTCGCGAGTCTCATGGTTGATGAGCTGTTGGCTGCATGGGACGAGTTCTTCGAG
ACTCTGTTCATGCCGAGTTTCACTGAGAAGGACGCTGAGAAGAAGAAGAAGATGCGCGAAGAGCTGCTTGCGGGCCCGTTGACCAAGGCATTGAACCGAA
TGGAAGCTCGCTACGCCCAGATATCGCAGTCCTCCCTCTTTGCAATGCAGCCGGACAAGATATTCGTGCATGATGTGCTTGCCTGGGACTACGTGGCGAT
GTTTCAAAGTGGCTTCATTGATCATATCCCTACAACACTCATGGATAAGTATCCAGCCATGATGACTGCCTTCACAAAAGTCGCTGCTCATCCACGCGTG
CAACAATGGACCAGCCGAGTACACCATGCACCACCGAAGAAGCTCAAGCTCACTtACTTTGACATGTCGGGgCGTGCGGAGCAGATCCgaCTCGCGTTTC
ACATCGGTGGTATTGCTTTCGAAGACGAAcGCCTTAGTCATGAAGATTTTGCCAAGATCAAGCCATCTCTGCCGTTTGAACAGGTGCCTGTTCTGCAGAT
TGATGACGGCTATATAATCGCGCAGTCCTTCCCcATCCTGCGGTACGCTGGTACGTTGGCTGGTCTGTATCCAACGACAGACCCATTGCGTGCGGCAAAG
ATCGACGAAGTCCTGGGTCACGTCGAAGAACTCTTTACCGCgACGGGGCCATCATTCTTGGAGACGGATCCAGAGAAGAAGAAGCAAATGCGCGAGAAAC
tGACGAATGAAACGATCCCCAAGGCACTTGAGACGCTTGAAGAACGCATTCGCAAG