Description :
From Genome Similarity Track
Location :
Scaffold_47:50571- 51643
Transcript NameFunction/comments
Hyaar_Emoy280617960S ribosomal protein L211 putative

Sequence
1072 bases(100 bases per row)
CCAATAGTTTGTGTCATCCTCGACTGCCCCACCTCATCCAGTTCTTCTTGTCTCGTTCCGACTTGCAGGTAAGCGATGCGATTATGGGGGAAGCCACGAC
AAAAAGTGGATCAAGAGGGAGAGAAGCGAAGGCACGACAGTCCAGTCCGTACACAAATTGGTCTATAAAAATAGCACGTCATTCAGAACTGCTGAATGAA
AAGTCGATGGCAGCAGCAGTCGATTAGAACTTAGTAGAGGTCTCTGAAGACAGATCTAGACTGCGAGGCAAAGCGCTTTGCCCTCTCCAGTTACTCGTCA
GCTGCTGCATCGTGCCTCCACTACTCTCCCCTTGTCCACGTTACAGTCGTCCTCATAGCTTCGATGCTGATGATGATATTGGGAACTACCATTTCTAACG
GGGTTGTGGTCGTGTCATTGATTGCTGCTACACAGCTTAGTCCAAGATGCCGCACTCTTTTGGTTACCGCGCGCGTACGCGCGACATGTTTGCGCGTCCG
TTCCGTCAGAGCGGCATGATCAAGATGTCGACGTACCTTCGGACGTTTAAGGTCGGGGACTACGTGGACATTAAGGCGAACGGTGCCGTGCAGAAGGGTA
TGCCCCACAAGTACTACCACGGCCGCACTGGTCGCGTGTACAACGTGACTAGACGTGCTGTCGGTGTGCGTGTGAACAAGGTCGTGGGCAACCGCATCAT
CCACAAGCACATTAACGTGCGCATTGAGCACGTGCACCAGTCCAAGTGCCGTCTCGGCTTCCTCACGCGCGTGAAGGAGAATGAGCTCAAGAAGAAAGAG
GCTCGTTCTACTGGCGTTCGCGCGCAGATTAAGCGCGTGCCGAAGCAGCCCAAGGCTGCCTACACGTTGAAGGCCAAGGGCACCAAGCCTATCACTATGG
CTGCACAGCCGTTTGTGGACCTCATGTAAGCAGGAATGGTGCTGTTCATCGTTGCTTGATGGCATGGGATGCACTACCTTCACTTTGTTGAAGGTGTGGG
GTACCATTCATTCCGTGCCAGCACGTCATAATCACCTCCAGGAGCTGAGCTTAATGAAAGAACGAGTCGAAT