Description :
From Genome Similarity Track
Location :
Scaffold_198:50553- 53143
Transcript NameFunction/comments
Phypl_g5135ATP-binding Cassette (ABC) Superfamily

Sequence
2590 bases(100 bases per row)
gacgGTGTTCTACGGCGACTTGGGCCGggactgctgccacttgatCGAGTACTTTGAGAGTATCCCGGGCACGGCTTCGCTTCCGCTGGGCTACAACCCT
GCAACGTGGATGCTCGAGTGCATCGTTGCCGGCGTCAACTCGGCCACCAACGCGACGGACTTCGTCCACCACTTCAACAGCAGTCCGCTCAGCAAGACCC
TGCACGACAACCTGGCCAAGGAAGGCATCGCGACGCCCTCCCCGGACCTGCCAGAAATGGTCTTCGCGGACAAGCGCGCGGCCAACTCGGCGACGCAGAT
GAAGTTCGTCGTGACCTGCTTCGTCCAGATGTACTGGCGCACGCCCAGCTACAACCTCACGCGCATGATCCTCGCCGTGTTCCTCGCTCTCGTGTTCGGC
GTCGTGTTTGTCGACGCCGAGTACGCGTCCTACACGGGTCTCAACTCGGGCGTGGGCATGGTGTACATGGCTGCGCTCTTCCAAGCCATGATTACCTTCC
AGAGTGTCTTGCCGCTGGCCTGCGCGGAGCGCGCCTCGTACTACCGGGAACGCGCCGCGCAGACGTACAACGCGTTGTGGTACTTTGTGGGCTCGACGCT
GGCTGAGATCCCCTactgcttctgcagcggcttccTGTTCACGATCATCTTCTACCCGATGGTGGGTTTCACGGACGTGTGGACGGGGGTCCTGGTTTGG
CTGGCGATCTCGCTGTTGATTCTCATGCAGGTCTACCAGGGAATGATGTTCGTCTTCTTGATGCCGTCCGAGGAGACAGCGTCGATCTTCGGACTGCTCT
TCAATACCGTCACGATGATGGGAATGGGCTACAGTCCGCCGGCGTACTCGATCCCGTCGAGTTACACGTGGCTGTACCGCACTTCCCCGCTCCGGTTCCC
GCTCTCCATCATGGCGGCGCTGATGTTTGCCGACTGTGACGAGCTTCCGACTTGGAACGAGGCCACGCAGTCGTACGAGAACGGGGGCTCAAACATTGGG
TGCCAGCCCATGGCGGACTCACCGGTGACGGTAGGCCACATCACGGTCAAGGAGTACACGGAGCAGTACTTTGGCTACAAGCACGAGTCGATCAcgcact
tcttcttcatcctcatcgGCTGCATCGTTCTCTACCGCGTTGTGGGACTCATCGCTTTGCGCTACATCAACCACCAGAAGCGGTAGATCAATGGGAGCGG
CTCACATGATACAGTTGTTTTCATAACATGAATGAACGTAtccatacatgtacatttTCCCACGGGTCTTCAACTCCCCTAGTTTGGAACTCCTTGGATC
ACTGCGACGCGGCCTCTCAGCGTGTTGCACCGTGTTTGAGCCTGCGGTCGAAGAGGTCGATACAGTACCTGCCGTCTGTACACGTGTGAGATCTATCATC
CAAACAGCGTGTACATATACAAATCCACCAAGCAGAGTACTGCTTTTTTAAATGCTCGAAGAATGCCCGCTGGCAGCACTGCTTCATTCTTCCTTCAGTT
CTGGACAGTTCTCACCACCTTGACCCAAGCGCATCGACTGGACTCAAGAAGTACACAATAGATACCCGCTCTCTTGTCTGCAACCATTTCCCAAACGAGT
TCACAAGAAATGGCAGGAAACCGGCATTAAATGATGAAATGTTGATCATGGATATGTTTGAAGCGTGCCGTGAACCAAATCCATGATTGCTATCGAGAAA
AGACCCTCACTGACGTGCCAGTGCTCGATCGTCATCCAACGATAGCCTCGATTCGGCAGCGGAGCCTGTGGAGTGAATGGGACGGCtaagctgcagctga
tgcCAATTGCGATGCCGTCGCAAGACTATACCGTTTCAACCAATTCCGCTTGCTTCTTCCCGACATCAGTGAACGATCTTTCGTACGCAAGGATACATAA
AAACTTATGTGTTTGACCCACCGTTCGTACAGTAACAGGGTCCACCCAGTCTTCGCGGTGTATAACGGGGAACCGCGCATGTGATCGGCGTTCAATGTCT
CAGCTAAATGGACCTGAAACTTCTTGCAGCATCTACTATTGAGCTCTGACGTAGCGGAGATTGTAGCAAACCTCTATCCCGGAAATACTCCAAACCTCTC
GCCGTGGTTTGGATGCTGACTGTGAACGCAAACCAATAttttacgtaattttggttcacaagcccgcgtagtttACGAGCAAAtcaatttcttgagcgtt
tcgtggtttggtttgttcagggtgtgagCTTTCCACTTAGCCATCATACATACAATCATAAGATAGGAGTTTGAGCATAGGATACTGGATAACTCTTGGA
AGCATACAAAAAAACAGTTAGTTTTTTCACCCGTTACCAAGCGTGCTATAACACCAACCGGCCGTGGCGCCACAGTCTTACTCGTAAGTTCTGGAATGAC
ATTACCATAGCTTGGTCTTTGAGTCCGGGGGCGCAATCCTTATCTTCTGGTCTTGTCCGCGCTTATCCACGCCCTTCACCCGTGCAGTTTGTCCCGGagc
gccgcttcttcgctcTCCCGGTGTCCAACATGCAAGCTCCGTGCACCGCCCAACTAACTTACACATGTAAAATAATATATCCGAGAAAAA