Description :
From Genome Similarity Track
Location :
Scaffold_16:50552- 52154
Transcript NameFunction/comments
g18055.t1OWZ05770.1 hypothetical protein PHMEG_00022073 [Phytophthora megakarya

Sequence
1602 bases(100 bases per row)
TTCTCTGACTACACACACCATTTTCACGCGCACGTCGCCAAGCACCGGATTTTGCGTAGTCTGCAGGAGCAACCAGCGCTTCGACTTACCTTTGAGCTCA
AGCGCAAGGCCATGAACATCCACGGCGCGACCACCTTCGACGTGGTGGCGACTCCGGCCCCGAAGGCAACCACTGGCGGAAAAAGTATGGTCTACAACGG
AATGGCGTCGTTCGAGAAGGACGGACACGCCCACGAGTATTCGCTTGTGGATGGAACGGCCTACTACACGCGACGCCCGAAAGACAACTCGGCGGCGGAG
AACGAGTCAGGATGCCTTCCGTCGTACTCGGTTCCGCCTATCGAGAGCGTGTTGAGCGCCATTCACGGTGCCTCCACGGCCACCAACCTGATCAAGCCTG
GTGATCTACAGCAGAAATGTCCTGGTGGATCCGTGATGGTGTTCCCATTCGCAGGTGAAGACTTCGTGTTATGCTCGCACTCGTCGTGGTTCAAGGACGA
CGGGTTTAAAATCCTAGGCTCCGACCTGAACATCGACGTGAAGTATGACCAGACCACGCCTACGATTGTGGCTCCGCACGTGTCGACAGAGGCATTGGCT
ACGTGCGGAAAGGTTCCGTTTGGCGAGCAGATCACTCCGTCGCTGCCATCGCTCATGGCTCGGTCGTTTTCGGAGTGGGGACACCGTGCCCTGCGCGCGG
AGGAAGCTGAATTCAGTCTGTGGAATCTCATCACGGATGATGTTTGCGGCTGCAAGGGCGCTGAGCGATCGTGTGTGTTTATTGCTGGCCTTAGCTCGTA
CGAAGACCACGGTTTGACCGATGATGACCCCGAAGGCTACTTTGGCGATGAACTCAGCGACCACACACCGTGTTGTTCAAGCAGGAAGTTCATCACGCTA
GCCACGAAGGATAATTCCTGGTACGATCTTGTGTTCCAGCAACGCCTCGTTGATCTCCTTATTCAAGCGAGCGGTACAAGTGATCCCGCTACAGGAACGA
TCAAGGACACGATCATTTTCGGCCACTCCATGGGAAGCCTCACCTTGGCTGGTGCAATTGCAAACGGCAAGGCCATTCTTGACCCGTCGACGTCTTGGGT
GGCTGCTAGCACTCCAATGGAAGGCAGCATGGGCTCGAACTACATTCAACAATCGTGCAGTGGGTCACAAGATGGCTTCCTGGCCAGCCTCATCGACTTG
TTGGGCAACTGCCCTGCAAACACTGGAGAGTCGTCACTTGTCTACCAGGGCTCGGACCTATCTTCGCAGACGTTGAATGACGCGTATGTTGCTGCGCAAG
CCGCGTACACTGCGAACGTGGATGCCGTAATGTGCAGCAAAAGTTTCACTGGCTTGGTGACGCTGAAAGCTGCTATTTACGCGCTTGCGGGTGAAATGCT
GCCGCACCATTCTTCGGAGAACGATGGTATCGTGGAGTACGCAAGCTGCGCCATGGGTCTTCCCCTTGACAGCTTCGACACCTCGTATAAAAGTGTGCGC
TACGTGACTGAGCTGAACCACGTGGATACGTCGTTCCGGAACGGCGATGGCGTCTTCAGTGACGCGAAGAAACCTTTGAAGTGGTTTGAGTGCCTCCTGT
AA