Description :
From Genome Similarity Track
Location :
Scaffold_614:5052- 6098
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_614-fgenesh-gene-0.6Microtubule-associated protein EB1

Sequence
1046 bases(100 bases per row)
TACATTTCCTCGTCCTGAGGCTCGGCGCCGCCCTCTCCTGCGGCAAATTCTTCTTCAGTCGCGTACAAAATCTTGAAGACGCTTTGCGCAACCGGATCTG
CGTCGGCGCCCTCCGTGCCTTGCAGTAGAATCTCGATGTCGCGCAGCTTGCCAAAGTAGAAGTCACGCTCCTTCTCCAGACCTTCAACCTATCGCAACAA
ATACACCGAGTCAGCAATCAAAAAAAATATCCCCACCCAACAAGCACAGCAAGTTCATCTCATCGAGAGCCTGCTACGTACCGCCACACGCAGCTCTCCG
TTCTCATTCGTCAAGGCCTCATTTATACCCGTCAGCTCCTCCAGTTCACGCTCCAACTCTGCATTCGCAGCCGCTGCGACGGGAGCAGCAGGGACTGCGC
CACCGGCGCTTCCCACTGGACGGCGCGTGGCACCCACGGCGCTCTTTGTGCCAGTCGCCCCCACTCGAGCTCCACTAACTGGCGCGCCTGGCGGCTTCGC
AGCCGCGGTGCGCGTGGCACCGAGCGTCGAGGCCGGCTTTCTTCTCGCTGCTGCCGCGGCAGTGGCGCCTGCAGGTGTCGGCGATGGTGCCGAGCCACCT
CCACTGCCACCAAACTTGCTCGTGTACAGCGATCCGCCCTTGCCCTTCTCGCGCACAGCGATCGCATCGTACGGCTGACCGGACGCGTTGAGCTCGTAGA
ACTTCTTGAACCACTGCATGAACTCGAGGTTGTCCTGGTACTTGCCGCGACAGAGGCGGTCGACCTCGATGTGCTTGTCGATCTTGAGGTTCGTGAAGCA
CTTCTGCAGCACCTTGTAGTTCTGGATGTACTCGTAGTCCTTGTTCGCGCTCCAGTCGACCTTGGACATGGGCACCTTGCCCGGGTACATCGAGTCGAGG
ATCATGCACGCGACCGCGCCCGTGCACGTCTGCTCCACTTTGCTCAGGCTCGTGAAGCAGATGCCGTTGATCCAGTCCAGGATCTCCTTGCGCCCGACAA
AGTACGTGCCGTCCATCATCGCGATGTTCTGATCCGCGGCCGCCAT