Description :
From Genome Similarity Track
Location :
Scaffold_807:5051- 6307
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_807-snap-gene-0.10Phospho-2-dehydro-3-deoxyheptonate aldolase

Sequence
1256 bases(100 bases per row)
TCCCAGCTCATGCACGCGTCCGTCACGCTCTTGCCGTACACGAGCGGCTGGCCCGGGATCAGTGCCTGGTTGCCCTCCTCGATGTTCGACTCGAGCATGA
CGCCAACAATGCGGTCGTCGCCGTTCGCGAGCTGCTGCGCAATATCGGCGGCCACGAGCACTTGGTTGTTGTGGTCCTTGCGCGAGTTGCCGTGCGAGCA
GTCGACCATGACATTGTCCACAATGTTGGCCTTAACCATGAGCGCCGAGGTCTCTTCAATGTGCTTCTTCTCATAGTTCGGGCCGGTTTTGCCACCCCGC
AAAATCACGTGGCACGTGTCGTTACCGGACGTATTGACAATCGCCGCAAGCCCCTGCGAGCTCACACTGAGAAAGCAGTGCGGGTGGCGCGCTGCCACGA
CTGCATCCACAGCGAGTTGCCTGAACAAACACAAGAGGGGGTTAAAACACCGTTCGACACGGCCAAAAAGGTGCCAAACAGAACGTACAAGGAGCCGCCC
GTGCCGTTCTTGAAGCCAATGGGCATGGAGAGTCCCGACGTGAGCTCGCGGTGCAACTGGCACTCGGTGGTGCGTGCACCGATGGCGCCCCAGCTCACGA
GGTCGCTGATGAATTGCGGCGACATGGTGTCGAGGAACTCGCAACCAGCCGGGAGACCGAGCTCGTTAATATCGGCGAGCAACTGTCGCGCGACGCGCAG
GCCCTTGTTGATGTTGAACGAGCCATTGAGATCCGGGTCGTTGATCAGCCCTTTCCAGCCGACGGTCGTGCGGGGCTTCTCAAAGTACACGCGCATAATG
ATCACGAGATCCTTTTCAAGCTCCTTCTTGATCTTGACCAGACGCTTAGCTGTAGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNATTAGATACAATCCCATCATAACAAGTAGCTCATCGAGACGTACCGTAATCCATGGCTGCGTCAACGTCGTGGATCGAGCACGGGCCAA
CGACGACCACGAGGCGGTCGTCCATGCGGCGCAGCACGTTTGCAATGGCCTGGCGGCCGCGGTTAATGGTCTGCGCAATCGGAGACGTAAGCGGAATCTC
CTCTTGGAGAATCGCGGGGGGCACAAGCGGGCGAATGCCCGTGATGCGCACGTCCATGATTGCCTTCTTGTCCGAGATCTTGACGTCCTGGCTCGCCGTG
CCGCTCGGGATACGAAGGCGCCGCGGACGCAATGGCTCGTCGTGGGTGCTGTTGCC