Description :
From Genome Similarity Track
Location :
Scaffold_2:50501- 52907
Sequence
2406 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAAGTTCTACAGCATAGTTTATGTGTAATTTTGAATTTCCACTTTTTTCGAGAATAGTCGTATCTATTTATTTTAGGTGGAGTCG
CACCTCTGTAAAAACTCTGGAATCCAAATCGTTATATTCAGAGTCTGGAGATAATTAGCTTTGTCATTTACAGGAATGATCCATCGTGGGAAAACACTGC
CATCGTAAGCCACTCAGAGATTTATCGATACAGCGAAGTGTGGCGCAGCCCAGTGCACGCTGAGAAGAGCAAAGGGACTCAGGTGCCCAACATGGTCCTG
AGCAGATAGGTAGCGGAGACAGCGTGTTAAATGCTCACAGAATATATGTGGCTTTCTCACCAACAAGTGGCCACTACCATACCACCGCACCTTTGCTTTC
CCAGCATTTTTGAGGAGAAAACAATAGCTATGTGTGTGATGCACTTGCCCCTACGCTGTATTCACCTTCGCAACAAACGGCAAAGGTACTGTCCTCCCAG
ATAAAAGCCTTCTTTTAAAGGGCAAAGTGTACTAGTGTGCCGTAATAAGTTTAAACGCTCTAGTGGTCGAATTGTATATTTTTTAGAGCGTTGTTTACAG
AATCCACATGGTAGCTCAAGAAGGCTACCTCCTTCCTTCAAAGTGAAGTTTTAGCGATGTTTAACCCCTTGAACGCGGAGGGATTCCAGTGCGCCCATTT
CCCGAAACCCTATGCATGCTAACGTTTATTTCGGGAAAGGGTTCCAATTGAGAGCTTATTATGTTAGTTATCCTGTAGTATGGATAATATGTCCCCCATG
ATTCCTTTGGTAGTTGTATGGAGTCAGAAGCGTAGTCATTCACAGCAAATTAGAGAATATAGCACGATGCGAAGGAGACTTGTTGTCGATGTGAGTACAT
GAAGAAAAATTTCATTCAGTCGACAACTCACATCAACAGCGTTTACTATAGAAAACGTACCCATATGATCTTGGCAGGAAGTCGAAAACACCATCATATC
GCCCAAAATATTCTATCTGATTGATTCGAGCTCGACTTGATCATCCAAATTTGAAGTAGAACCCACAATATTGTGTTGCGTCTCTCAATCGAATGATACT
TTCTTTCTAGTTGCTAACGAGTCCGCTACCTCCAAGACCCGGCTCCACTAAGAAATCGGCTCCCTTTTTAGAAGTTTTAGAAGTAGAAGCGGGCTTGACA
TGTGAATAGAGCTTGTTGATTGGCTACTCCAAGTGAGCCGGCTAATATACAGCCCACGAAATACCGATGTTGGGCTCGGCTCGTCTCGTATGCTAAGCAA
GCTCCGGCTTCAGTCTCTGGTGTCATTCTTGGCGCTCAGTGAATTCATGGATTAAATGTTACTCGAAGGTAATCAAATGAAGAGGTCGTCCGTTTCTTAC
GCTTTT