Description :
From Genome Similarity Track
Location :
Scaffold_155:50497- 53188
Sequence
2691 bases(100 bases per row)
GATAAAGGTGTCCGCCATGAAGTTGACTTAGTTCCGGGGACGAAATACTGTATCACACGACAGTGGCCCTTGCCTAAGGAGCAATGTGATGTCATTGATG
ACTTCTTCCATGCTAAGCACGAGGCAGGAATGGTACGTGAGAGTAAATCTCCACATTTGACACCGACATTTTGTGTAAAAAGCCGAACGGCAAGTGACGT
ATTGTGCATGCTTATAACAAGCTTAATGCGACTACTATTCCGGTACAGACACCCATTATTCGAAAGGATGTTCTTCAGAACAACATGGTTGATTGTACTA
TGTATAGAGAACTAGACTTGACCGATGGATATTACCAATTGCTCATGCGAGCGAGTGATATTCCGCTTACAGCAGTGAGCACTCCGAGTGGTATGCTATG
GGAATGGCTGGTGATACCCCAAAGGCTGTCTAATGCTCCGGCAATATTAATCTTCTGGTGACGCAACTTGTCCACCCACATCGGGATTACGTACAGACGT
ACTTTGATGGCATTTTTGTCCATATTCGTGCCAAACAAGGTCGGTCAGATGTTGAAAATCACATCAGTCATTTGCGAGCCGTGATCGAGTGCATGCGCAC
TAATAAATTGTACTTCAACGCGTCTAAATGAATTTTTGGTGCAGAGGAGATTCCTTTTCTCGGATATTTCATTGGTAAGCGCGGCCTTCGAGCGGACCCC
ACTAAGGGTATAGTGGACTAGACGATTCCTAAGAATCAAAAGGAATTGCGTAAGTGGCTTGGCCTTGCCAATTACTTACACAAATACAGTGAAATTTACG
CTGATATGGCTCGGCCATTAACTGATATCCTTAAGAGGGTCATAGATTGGCGCTGGGACAACACCCATGCCGACGCATTTTGGCCAATCAAGGAGAGTCT
TCTCCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTTAGTGTTGTCTGCGATGCATCCGACTTTGCCATCGGCAGCGCCCTGTTACAAACA
GATGCTTCAGGCCGCGAGCGAGTTATCGCATTTGAATCTCGTCAGATGAAAGCTGCTAAAAAGACCATTCCAGTTCATGACAAAGAGCTACTTGCTATGA
AATATGCGCTCGTCAAATTTAGAGTCCATCTGCTTGGCTCCAAGCCATTCGTCGTCTATACGGATATTGTGTCATTATGCACGCCGACACAGTTGCCTCA
CCTCTCTCAGAGAATGGCTCGGTGGATTTCCTTCTTTGCGGAATATAGCTTCGAGGTGAAGTATAAGCCAAGCAAGCAAAATGTGTTGGCAGATGCCCTC
TCTCGCAGACCTGATTACGAGCTTGCTCATGTCACGACTTTGACGTCTCCTATTAAGGAGTTAATTCGTGTGGCATATCCACGAGATCCTTAGTGGGTGT
TATTGTTTCATGCCCGTGGGATTAAAAGATACAAGGAATCGGAAAGTCAATTTTCTGCACGCTTGCGGGCCAGCCTACATCAATAATTCCATCGATAATG
GCCTCTTGTGCTATCGCACAGATTTTGCGGATACCGCTCGCATTGTTGTACCTCACGATGAGGATTTAAAGCATCGAATCCTCTTTGAGACCCACGATAC
TGCCCTCAGTGGGCATTTGGGCCGGGAAAAGACTTATGGCTCTGTGAGTCAACACTACTGGTGGCCCAAACTCTACAAATGGGTGAGCACATACGTGCGT
ACATGCGAATCGCGCCAGCGGGTCAAACACTCGGCACATTCGGCTACGCCACTCGCCAGTTTACCTGTTCCCACGGGGTGTTGGGAGTCAATCAGTATGG
ATTTTGTGTTTGGTCTTCTCAAAAACTGTGACGGCAATACGGGAATTGTGGTCTTTGTTGACCGTTGAAGCAAGATGGATCACTTGGCAGTGGTGCCGGA
TTCCATCGATGGCAAAGGTACAGCTATGCTGTTTATCGGTCGTGTGTTTCGTCAACACGGGTTGCCGCTAGCAATCATCTCTGATAGCGACCCTCGCTTC
ACAGGCAAGTTTTGGACTTCCATCTTCAAGGTGCTTGGCACGCGATTGGACATGTCCACAGCGGATGATTTGCATACCGATGGTCCGACTGAGCGAGTTA
ATTGCGTCATTGGTGACGTTCTTCGCAGTGTTTGTGCTGAGTCGCCACGGACTTGGAGCTCGATGCTCCCGGTTATTGACTTTGCGTTGAACAACGCTGT
TCATGCCTCGACCGGTTTTACTCCCTTCTATGTGAATAGCCTCACGCACCCCCGCATTTCGATCACGTTACCACTACGTGCTTCTGAGCTTGTTGGTGGA
GAGTCTGCTGACAAGCTTGCTGAAATCAGCCCTACCACGATGCAGAAACAAGTGAACGGGTTTCTCGCGACACGCTCTAGTGTCTTACGACATGTGCGTG
ATGCAATGGCTGCTAGCCAGGACAAACAAACAAAATAAGCTGATGCTAAAAGCAGAGGATGTATTGATTCTTATGAAGTTGGAGACCAAGTCTTTCTAAA
TGTTAAAAACCTACCTACAAATGTAGTGTCTGCCGTCTTGAAAACGACAGACACTACATTTGTAGGTAGGTGCGCCCGCGCTTCATTGGGCCGTTTACGG
TCATAGCAAAGAAGGGCATTGCCTATACACTCAATCTCCCGCGCAAGTTGCGCACACACCCAGTGTTTTGCGTTGGCTTGCTTAAGTCATA