Description :
From Genome Similarity Track
Location :
Scaffold_62:50494- 57172
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_62-fgenesh-gene-0.5Protein phosphatase 2C
Pytve_DAOMBR484maker-pve_contig_62-fgenesh-gene-0.14GPI ethanolamine phosphate transferase
Pytve_DAOMBR484maker-pve_contig_62-snap-gene-0.34Mediator complex subunit 4

Sequence
6678 bases(100 bases per row)
CAGGAACGATGGCGCTGCGGCAGAACATCAACAAGTCCGGCTCGGTCGCCAAGCTCCGGCAGCAAGAGGCGACGAACGCGAATGTGGCATCGCCCAAGGG
CATATCCACCAAGACGCCGGGGATCTCGCCGTCCAAGGCCGGGCTGAGCGACCACACGCTTGGGCTCCAGCGCCGCCGGCTCTCGGTCGTGAGCGACAAC
AAGCTCGTCGAAGGCATGGCGCAGGTCACGACCAACGACGTCGACTACGTCGAGGACGGCACGAGCGCCGTCGCGGCCTACGCCGGTCTCTCTAAGAAGG
GCTACGCGCCGTACAACCCGCGCAAGAAGAACCAGGACGCGATGATCATCAAACACGACCCGGCGACGCATTCGCTGCTGCTGTGTGTCTTTGACGGTCA
CGGCGAAGCGGGTGATGCGGTCTCTGGAGCTATTCGCGAGAAGTTCCCAGGCGAGCTGTTCAACCACCCGAAGTTCGCGGCGTCGGGGAACCTGGCGGAT
GATGCCGAGGCGATCCAAGTGGCGATGACTGAAGCGCTGCACAATGTCGAGCGCTTGGTGCTCCAGAACCCATCGATCGACACCGAGTTCAGCGGTACGA
CGGCGGTCGTCACAGTCATTCGCGAGAACCTAGTCGTTGTGGGCAACGTCGGTGACTCGCGCATCACTCGGGGCTATGTCAGCGGCGAGGGCGATGCCGC
AATCATCGGTTGCGACAGCGTCTCCAGCGACCACAAGCCCGACCGACCGGACGAGAAGGCGCGAATCATTGCCTGTGGTGGACGCGTGTTTGCAGTCGAG
TACGATGATGGCATCGATGGTCCGCCACGCGTGTGGCTCGGTCACATGGATGTGCCAGGGCTCGCGATGTCCCGCTCGCTCGGCGATGCGGTGGCTCACA
CTGCCGGAGTCACCTCGGAGCCCGAGTTCTTCACGCGGTTCCTGGACGACCGCGACCGGTGCCTCATTGTCGCGACAGACGGGTTGTGGGAGTTCATGTC
GAACGAGGAAGTCATGGAGATGGCGCTCTCGCAGACGGACCCCAAAACCGCCGTGGATTTGCTCATCATGGAGGCCAACCGGCGCTGGATGAAGGAAGAG
CAGGTCATCGACGACACCACCGTCATCGTCGTGTACGTGAACATCAACGACATGGCGCCGGTGGCTTCTGCAGGTGCTGCTGCTTCGCCTACTGGCACCA
GCTAGTGCAGGCTTGGATAGACAAAACACACCTCATTCTGGATGCGCCGCCTCCTCTATTTTCATTTAATTCCACGCCGCCACCCATACAGAACGAGAAT
CTATCATACGCTGCCAACCAGGTCTACCAGGTCACTTCTAGAACCGCTTCTTGTCGTCGTAGCTCACTGCATCGTCCTGTGTAAGGTCGCGCACGAACGT
CTTGGCAAGCAGAAAGAGCAGCGGGATGAACACGATGAAGGCGTTGACGATGCCGAACATGGAGATGGAGTTGCCGATCTCCTTCCAGCTGCCTTCGTTC
CGCACGAGGAACAGGAAGTGCAGCGCCAACACGTCTGACATGCCGACGACCAGCAGGAAGTAGCGCGAAGGAGCGAGTCGCGGCGGTGGCTGGAGCCCAA
GGATGAGGTGGAAGGCGCATGCGACGACCATGAACGGGATCAGGATTTTGACGACCAGCAGCGCACCCATGATGAACGGCGAGAAGACCGTGACGAAGCG
GTACGTGGACGAGATCTCGAAGCTGCTCATGCTTGCGACGTTGCCCGTGCCAAAGAAGGCAATGTTGACGAGCAACAGGAACAGGAACGCGCGGTGCACC
TCCGACATTCCAGTTGAGTCGCCAGGCACTGTTGATGCAGGAACGGTTCGCTGGTGGATCCGTTGGGCTGTGGACGCCGCCTCGCGCTCGACCCACGCGA
CGAGGACGCAGCAGAGCGCCACATAGAAGAACACTTCGTACGAGATACTGAGTAGCACGAAGGACGGTGCGAAAGCCAACATCACTTGAACCAGCCGATC
GATGGAAACCTGGGCCTGGCTCTCATCAGTGGCGCGTTTGTCCGTGGACGCTGGCTTGGCAGAGGCTAAGCGAGTGCTCATTGCAACGATCGGTCCAATA
GCCAGTAGCCAATTCGCGACGGTCAGCAACACAGGAGGCTTGCTCTTGCTGTCGAGGAAGCCCATCGTCAAATACAACGCGATCAGCGACAAACCCAATG
GCACTGACGAGATCGTCCAACCGGAAGCACCGCGAGAGTTCTGCCGGAACATTGCGTCCTCGATTCGCGCAAAGTATCGATCCACGAGGTAAGGAAATGC
GATCACCACCGCTCCACCGATCAGCACGAGCGACGTATGCTCGCCGTATTCGCTCGGTAGGTACGGGAACACGGACAGGAACAAACAGCTCCCAGACCAG
TAAACGGTCGACTTCCACGCAGCCCGAGAGTCATCTGCATTGTCGCCAGTGTTCATCTTGGTTTCGACCAGCGACCAACCCGCGAGCATCGTGAACAGCA
CGCCAAAGATCGCGCGCCGCTCGTAACCAACCACGACCAGCTCGAGCGACACCAAGATCAGCACGACTTCGATCCATTTCGCCTTGGCGAACCCGTCACG
TCCGCCGAACACACTCAAAGGAGGTAGCAGGCGGCGATGGTTCCACACAAAGTTCCAGTACACGATCGGGAAGCTCACGTACAGGTAGTACGTCGCAGGC
GAACTCTCGAGCGCGAGGTATGTGAAGACAGCGAAGACCGCGAACCAGAGCTTGATGTCCGCTTGGTCAGCGAGGCTGCGAAGGCGGAAGGAAGATGGAT
GCAGGTACGCGATCGTGATGACAAAGATCCAGCCGACGTATCCGATGACGATAACGCTCAGCAGGAAGAACCAGTCGTACCGCTGGAAGTACTCGAGCGT
CGCGAGGCAGACCTCGATCATCTCCTGGCTCGTGGCTTCGACCTCAGAATAGTCTTCCGCATCGTCGCGGTTCCAAGTCTCTCGGATACGTCGAGCGAGC
GACGGAACCAGCTCTCGAAACGGGCGGTACGGCTGAAAGTACAGCAGCGTGCGCGCCTCCTTCTCCTGCTCCTTGCGCAGCGCGTGGAGGTAAAGCTGCT
GCGCGTTGAACATGACGGCCTTTGCGCGGTATTTTCCCTTGGCCAGAAACGAGAAGGGCAACACGCCGACCGAGTTGCGCGGGTACGGCAGGCCGAGCAG
CGAGCTGATGAGCGGCGCCACGTCCGCCTGCATGACGTCCTTGCGCACAAGTCCGGCCAGTTTGCCCCACTCGATAGCAGCTGCGAGTTCCTGAGGCTGT
TGAGCTTGAAGCTGCGCTTGGACTTGAGCTCTCGACTGTGTGGGCAAGTCAATGTCGAAGGTCTCACCGCTCGTCTCGGTTCGAGCACTCGTTGGGCCTT
GAACGCCAGCTCCCCAAGCGACAAGCGGGGTTCGCGTGTTGGCCGGGTCGCCGTCGCCGTGCGCACCCTTGAGACTCATCCCGTGGTCGGCCGTGAACAC
GTACGCCGTCTGTCCGTCGTAGTCGTAAAAGTCCTCCAGCAGCCGATACGTCTTCTCCACGAGCTCGTCCACGAGCGCAATGTTGTTGAGGTAGTCGGGC
GAGTTGGGGCGGTGCGCGTGGCCGTTCGAATCGATACCGAGGAAATGGCAGAAGAAGACGACGTTGTCACCGCGCAGCTCCGCGTTCAGTGTGGCGTTCG
TGCCGGCTCGGGCCATCAGCGCCTGCAGCTGGCGGAACACCCAGACATCGAGCTCGGACGAGTCGGCCTTGGCGAAATCCTCCTCTTCGTGCGAGTAGTG
CCACTCGGTCGCGTGCTCGACATTCCTCGCAAACATGGGGACAATATCCGGGCTGCCGAACAGGAACGCGTGTTGGCTCTGATTGAAGACCGAGTCGAAA
TCCACCGGGTTGTCCTGCCACCCCTTGGTCACGGCGCTCACGTCCTCGTACATGCCGGCAAAGAGCGCCACGTGGCCCGGTCGGCTCTCGGTCGGCACGC
GGGTGTGGGAGACACCGTAGCTGCCCTGCTCCAGCATCACGCGCCGCAGGAACGTCACGCGCTGGTGATCCTCATTTGGCGTCTGTATGAGCGACGCGTT
CGCCTCGAAGAACTTGTCGGCCCGACACCCATCGGCCACGAACACGACGACGCGACGCGCCGGCGCGCGCAGAGAGGCCTCCGCGTACGGCGCGCTCTCG
ATGTGCGGCACCACGGGAGACTTGAAGTAGATGTCGAAGATGCTGAGCACGTAGGCCGCGTGGAAGAGCACGCCCAGCACCAGCAGCCGCGACAAGCTGC
CGCCCCCGGTGCTCGCCATGCTGTTCGCCGTCGGATACACTTTTTTCAGATGTGACGAGCTGTTGTGTTCAGATGAGAATCGACATGTCACTCTATTGGG
GTTGGTAATTCGTATGGGGAAATGTAGGGCACAGTCATAAGCTATTCGACTGCCTGGTGAAAGTGCATGGCAGTGCTGTCTTGAATACGTCTACTGTGTC
TGGGCTTGCCACTTGATGCCTTGGTTGTTAAGCGTGGTCTTGAAGTGGCCGATCAGCTCGTAGATCTCCTCGAGCCGGCGTTCCAGTTTGTCCATGCGTT
GGGAATCGGACTGCGGAGCTGTTGTTGGCGCAGGCGGTTTCACCTCGTCCTCACTTGCCGTCTTCTCGTTACCGCTCTTCTCGAGGGCGTCCATCCTCCA
CTCCATTCTCCTCATCTGATCCATCGACTTGAGCCTGAGCATAAATGCGAACTTGTGCTTGATCGAGGCGTTCGACCAACTGCGCTTGAAGACGACTGGC
GCAATTTCCAAATTCAACAGGCAAGTGATCGAGGCAGCTGCAGCGAGTCAAGCAGATTGATGCTCACTTGTGTTTGAAGATGTCCATCTTGTCAAGTGCC
TTCCTGATATTGAGGATCTTGAGATATATCTCCTTGAGCTGGTGCATGGGGGGTTTCCACCATGGTGCTGACATTAATCAGGAGGATTTCGCAATGGAAG
GATATTCAACTTGTTGTCAGGGCATTCCTAAGACATGACCGCAGAGTAGTCCGAGAGCGCAAAACGAAATGTTCCAACCAGTGACCAAATGGGAGCTGCA
ATGAGCTCAATCATATATCAATGGCAGGCTACGATACATACCACTCGCTGTTCAATCACTGTCCTCATCACTGCTGTCCTCGTCGGACGAGAGACTGAGC
GATATCTTCTGCGGAGCCTCTTTATCTGAGTCGTCACTGTCGCTCGAGTCACTGTCGCTGTCGCTGTCCTCCTTGCCCGAGGCCGTCGTATCGCCGCCAG
TGTCATCAGCGCTCTCGCCGCCATCGAGCTTACGGCGCTTCCGCAGTGTCTCGACATCATCCACGACCTCGTCTTCGTACAGCGCCGCCCGCTTCTCCGG
CAGCTTGAACTTTTTGCGTAGGATCTCCATTGCGTCCGGCGGCAGTGGCTCACCCGGCTTCCACGACTCGGGCAACGCGATCCCATGCTCCTGCAATACG
CAAATGTGCAGTGTCAGCACCATTATCCAACTCCATGCGATCGTTCCACACGCACCACAAAGAAGCTTCGCCCCATGTAGTGCAGAAGAGCGTCGAGCGG
AAGGTCCACCGGGTCGCCAGGCTTCCATCCGGGCGGCATCTGTTTGCGGATCTGCGCATCGCTGGCCGCGAGACCGATGGGAATGTTGAGCTTGTCGAGG
GCGTCGCCCGCGCTGCTACCCTCCTCCTTCTTCACCTTGGCCGCAGTTGACGAGTACGATTCCGGCTCGTGGGTCACGATCTCGTCCACGACGCCACGAC
TCAGCACGCCAGCGCGCATCATGTGCTCCTGTGGAGCCGGCGGCATGAACCCGAACATTGGGAACTGAAAGCAACCCACGAGTTAGAGTTCGACCAACAC
AGTAAATGCCGAGATTTGCTACGTACACCTGGCCGCCATTCTTTCGGGGCGGACGTCGTGCCGGCGATCCGATGCGCGTACGCCACGACATCACGGGGAT
CAAGCACCACTGGTCGGTGTCAAGTAATCATCCATCCAGCATCGTTGTCAGCGACATCAGCTGTTAGACGACATTAAAACAGCGCAGCAAGCCCGCACCT
TTGGTCTTCTGACGAGCGTGCTGCAGCACTGTCTGGTGCTTCCGCAGCACACTGGCAATTTCCTGTGCGATGCGAAGCAAGGTGCGAGTCAGCGAGCAGC
TCATCCTCCGTTCCGACCGAAAAATGCAATGCTTCTCACTTCCTGCGACCGCCGCAACTGCCCAGCGTAGTCGATGACCTTCTGCTTCTTGCTCTTGATG
TCGTCCTGCAGGCGCAGCAGCTCCCGCTGCGTTTCCTGGTGGCGAGCGACTACGGCACAAACACGCAGCGTGAGGGAGGGGAACCAAACCACGAGCGCTA
TGCGATGCAACGCACGCTGCTTAATAGCGGCCAGGAGATCGCGGTCCTTGTCCAGAACCTTGGCGAACGTGTCATTCACGGTTCGCAGGCGCGTCGACGT
GATGGTCGTCGGCGGGCTGTTGTGAACCATGATAAGAAAGCCCGTTCTCCGTCAGTTTAGGATCTGCCCGAGCGCGAGAAGTGCGGCAGGAGCACGCACA
GCAGCGCCGCATTGAGCGACTCGAGCAGCTTGGTGACGAGGAAGCGGTGCTCGTGCACGTGCACCTCGACCTGCTCCC