Description :
From Genome Similarity Track
Location :
Scaffold_34:504823- 510615
Transcript NameFunction/comments
Phyin_T30-4PITG_14366Putative uncharacterized protein

Sequence
5792 bases(100 bases per row)
ATTAGTCCCCCACATCCACCTCACGCAGCTCGAAAAACACCCATTTTAAATACTTTTTATTCAATGAAAAAATTCCCTACACCCCTTTCAAATACTACCT
CCGTCCCACAAAAAATTAACGTTTGGTTCTAATGTGGTACCCATTAAAGTGTTAGAAGCATTGTATTGGTCAGCAGCTAATTGCTGGATTTTCATTATTC
GCTTTAGGATTGCTGGAAAATGAGCTTACGATACGTTAAAGTTCCACTAAGTTCATTTTTAACTAGAATTTCAGATTACCGGTACCTTCGTGATATTTTT
TTACAATCCGCTTAGATGCGTGGAGAAGCTAAATTTGTGATTAGGCCTCTCGAATTCCCAGCTGCGAAAACAAAACTTAAGAAGGCTCAGTTCATAAAGT
GGGGCAAGGATTTTCCCGTCGCTCCCCAAAATCACCCTAATTATGACAGTGTAATCTTCCTCCGGTGGCTCGTTAGCGTAACGCAGCAAATACATAGCTG
AAGCGCTCGTGACGAGCGTTCGAATAAATGTTTTGCGTGCTGATTGGGTGCGTAGACGACGCGCAATGACACAAATAGAAAGGTTAAGTGTTTTGTGGGA
CGGTGTGGTGGATGGTTGGTCTTTAGCCAGTTTCCACCCTCCGTTAGCTGATGATCACAGACTGAAGTCCTGGTGCAATCAGTGTCTCCTCAGCCAAGCA
GTGCCTGACTCGATCAGCACTGTTTCATTGGTGACTTCGGAGCCAGTCACACTGGGTACGATGAAATTTTCAGGATTCTTGATAAAGCGGGGTACCAGAG
ATCCAAGAGGAATCTACTGGAAGCCATACATATTCCCTCTCGTGCTACCATCAGCAAGAAGACTTCGTACTTACAGTGAGAGCTATAGGCAGTGATGTTG
GTCTAGAGCGCTCACTTACCTATTTACTAGCTACTGCGAAAGCAGCTCAATACGCTAGGCTACAAGTTTCCAGCGGGATCGCCACCTGCCCCGCCCTGTG
TTTCCTGAACTGCCCATCCTCCGGAAAACAATACAGAAGGAGATAGTACGTCATGAGTGCTACCATACCCTCTTAAGTGGAGCCACCATCATGATGATCT
ACCGCAATTTGCAGTATAGCTTCGTGGTCACCAAGGAATGTTTCATGCGGATATCCGAGTCGCGCATTGCACGAGCGTGTCGAATGTTAGCACGCTGTCG
AGAAAATACGCGGGGGGGCCTAAAGGAAATTAACATTAAAAGAGACTCTCCTGGCAACAGCACTGAAGAAACCTACCGTGAGCCAAGCCGAGCTGCACCC
GAGGATGATGTGGCATTCGCTGGTGGGGTATTGCGAGGTCGACATGAAAACAAAACGCGCATGATAATAAAATATATATAATTATAATCGTATTTTGCAA
AGCCTAATGAGATGGACATCCCTGCAGCAATCTCTATTCCCCTCGATGTGACAGAGGGCAAGTGCTGATGGCGTTCGGCGTCGTGACGATACCTGGATCA
TGCACGAGAAGCGTCATAGTAGCTCCCTAGGGCCACCGCCCTGGGTAAACCTGTACGAAAAGATATTTTGGCTACTAATCGTAATAGCGTTAAGCTAACA
GTTTGATATAACCGCAAAATCAGATCCAGTCGGACAAGAACGACATTCAAACAACCTTATGTGTAGCCAAGTTTTACAAGTGGCAAAAACACTGCACAAA
GTCTTAAGCTCCTACATTTACCAAGTAGTCTTATTGAAATGAACGTTTATCCTGGGAGGACAGCTAGAGGAGCTGTATGGACAGCCTCACACACATTAAT
TCGCTACAAAATTGTTGCCTGTAGCACAAGCAACTTTCAGATTACATCACGACACACAGGATCTACATAACGTAGTTCATCAATTGATGGACCTCAACCA
AGTTCATGAGCCAATGCGCATATTGTCCAATAAGATCATTCTATATGTGCTTCACAGTATGCTATTGGCTATTCAATGCTTCTACCAGTTCATCACCCAG
TAAATTGTTTCCCTCCCTAGTGCAAGATATAATCGCAGGGGGGGGAAGATGAAGACCGCCTTCACGGAGGCTCAGCTAGAGGAAGCAATTCAACGCGTTC
TCGACGGTGCAACTCGGGTTGCTGTAGTTGTGTCGTCATCCGTATCGCTACTAACGCTTAAATGAAAAGTCCGTGCACGCAAGGAATGGCGCGAAGAAGG
TCGCTAGCGCCCTGGACCTGTTCCAATGCTGCACCCTTAATGTGAAAACTAGTTCGTCACTTGGATTGCAGCAATGCAGCGCCAGCTTGTCACAATGCAA
CTATGGGAGGTAATCGAAGCCGCCAACAAGATCCACCACAAGATCCAAGGTAATCTACGCTCTGTTAAGGACTTAACATCAGGATGGTACAATCGGCTCA
TTGGGCGTCACCCGGAGCTATCTATGCGAGCCTCAGAATTTCTTTCGCGAGCTCGTAATGACGTTGATTTGGTGGCTGTACCTGACATGTTCAACACACT
GATGAAGCTGGTCATCGAGCACAACCTAGACAGTAGTCTAGCCTGGAATATGGATGAGACCAGCTTCATCAGTAAGCATCAGTCGGGAGCTGTGCTAGCA
GTACGCGGGTCTGCGAATGTGTGGACGGCGGCTAGTGAGACAACACTTCACCTGTCGGTTGTTGCTGCTATTAGTGACGAAGGACGTGCCGCAGCACCGC
TCTACATTTTGCCAAACAAAAGTGTTCGTCGTACCGCACTAAACGGCTGTCAAATCCCAAATTCCGGAAGCGCCCAGGGGCTTTCTTTATGGTTGTATTT
TTGAAATATGGATCGGTCATTTCGCTGGTGTGATCGGAAGTGAAATTTCTCGCCCAATCACTCTAGTATGCGATGGATGTTCGTCGCATATGGGTTCAAG
GGGTTTCTTTAAGCAAAAGAACTCAAGATTATTTTTTTTTCTACCCCCGAGCGCAACACATCTAATACAACCACTGGGTATTGCTGGATTCAAGGTTTTA
AAGGCTGATGTCCGCAAGATGCTGAAGTACGTGATCAAGTCGCCACCGGATCTCAAGATCTCAAAAAAGAGGTGGAGGCTACCGCTAGTTGAGCTTACAA
CAATTAACTGATTCAGGACATCAAAGCCATAATCAGTGAGCTTCGAACATGCGGGATTTTTCCGCTCTCGCTACCTAACATGCAGGCAAGATTCAGTAAA
TGCTGCAATAGAGGCATAGTGCGCAGCGAGCTTGGACTCGCTAACTGGTTGAGGATGCAAAGCAGCAAATCTTGGCACTTCCACCGTCGCCAGTACGCAA
GGAGAGCTTTCAAAAGACAATTGACGCCAGCAGCAAAAGCTTACGCAAGCAAGCCTTGCTGGTGACGCCGCCTCGCAAGAAACGGGTGACTAGCGGTGGT
GCTCAAGCTCCAGCTCTGGACTCGGTAGGCAGTACCAATAACGACGAGTCTGCCGTCCGGCCACTATTCGCTGTCGAGGTCGTGGAGAGCGCACTCGTCT
GAATGTTAGTGTGGATGTTTGCATTGACACATGTAGCTCATCAACTGGTCAGCGTATAAGAAAAAGAAATTCTCCTCTACTTTGAGTTGGCGCAGCCGCA
ACAAAATACGTCAACAAGTGACATGGAGCGGTTGAAAAAATCTTTATCGTATACTGATTGGCTAGATACTACAATATTCGTTCCAGCTCAAAGATTTGAG
TTACCACGAGCAATTTCCCATGAGATGCCCGCGGAGGGCCATGAATTAGTGAACTACGTTAGTTAAAAATTTGACGTGGGTTGCCTTGATTCTGACGACT
GAGCGTGTTTAGCAAAGAAACAGAAACAAAGATGGAAATGTAGCAAACATTGTTCTACTATCCATACCCGTAACGATGTCGGCAAGCGGCACGAGCGATG
ATATATTAGTAATTTTCTTATCTAAAATTCTGCGACTTTCTAAGTGGATGTAGTGTTGTAAAGAGACAATTCGATTTTCTTACGAGTGCATAAAATAAAA
AGAAGTGGGCGCGTACGAATCTGTATATCCACCGCTAAGACACAGTCTTGGGACCAAATTCGACCTTTTCGCTTCCATTTCCCGTACTTATAGCAAAGCG
CATTGGGGAAAGTGGCTCTTATCTGAACAGCTTGATTGGGTACATAATTATTTGGTCAGGAAGCGTGAAATGGTCCAAAGACACCAAGAAAACTCCAAAA
CACGGTTAGCTGGACGAGTTTGTGGAGTGGCTGCTTTGATGTGCTAAGCAGAGATCGGAAAAAATTCTGTATTGTATTGGTGGCAAAGTTTTGCCGTAAT
AAAATTCGAATATGAGCACTTTCAATTAAAAAGATTGCCGTAATTTAAATATATTGGGTCAATATCTAGCTACGTCTTGCCCTGTCGTGTACTCTTGCAT
TAGCCGTGATCCCCGTGAGTATGCTGGCCCGATAGTCAACTGGCAAAGCCACGCCAAGCTCCTTAAAATTAAAAGTCGTTATCATGTTCTGTGGTAGGTC
TGACGACGGCTACCAGGTTAATTATTGAAACCCCACCCAAGCAACTAAATAGTAGTCGTGCCCGTCGTGACTAGTTTTCTTATTGTATATTTTATCTGCA
ACATATAAGTCGGGGCAATCTTCGAATTCTGAAGTTTCATCTTCTGAGTCCGTGTTATCCTGGAGAGCCTCCAAGAAAGGCCAGCACCAGGGCTATTCAG
CGGCTCCCTTCTCCAGTTCCTTAAAACTTTGCTCCAGGTTGTCAGGTAGACTCGTTTTTTTTTATCTTCTTCTGTCGTTTGGCGCTAGCAAGCGCGTGTA
GTTGCGTGTTTCGTTTGGTTTTACGTGGCATTGCCGGCAAGTCTGAAATGTAGTTGATAAAGATTTATTTTAAGAGTAACAGAGTCCACAAGGAATAAAA
GGTGTTTAGTGATAATAGAGCAAATCAAGCACAGTATTTATTCGCTTTGTTACTTGGTCACATCCGCTACAGTACTAACACCCCACATATCGCGGCTAAC
ACGGAGGAACCCCAGCTCCTCGAAGTTGGCGGTGTCCATGGAGCGGCGCTGTGGTGTCAATACTAGCTTGCACTGGAAAAATAGCCGTTCAACGATGTTG
GAAGTTGCCGGAATCATCTTCACCAGAAGCAAATACCATGTCATGCGTGGCGTCGTGCTTGCGCTTCTTTCATCCGCTTCTTAGAAGCTGCGAAGTGTAG
TCTTCTTCTCCCTCTTTGCGCTTCTTACCTGCTAATTGTGATGCCTCGAATCGTGTTTATTCATAAAGCCTTCGCTGAAGCCAGTAAATATTAATTGATA
ACTTTCACAATTGCTGTCTCAAAATCCGGCTGGAGCACAATTTTCGCTGTTTCCTTCAGAAGTTCTCCCATAACAGAATAGTCAGTCACAAGTGCGTCAA
ACATCACTCGCACCTCGGCGATATCCGTTTCATCTCGCTGTAATCGTGGACAGATGCTTTCAAACTTCTTCATATGTTCGAAGAGATCAAGAATTTTCCT
GTGCTTCGCGCCGGTCGGGATAAGCTCTTCAACAGTTACCACCTTTTTGATCTCAGCTCGGATTCGAGTATACCGCTGCACCATTGTAATTGTGGATGAC
CAGCGAGTCACGTTCCGCTTTACTGGAAGAAGTTCTGTGTGTGTTTTAAGCTCAGCGTAGTTGTTTTCGTGGCGTAGCTCGACCATAAGGTCGCTTACTT
TAGAGAGCAACGACTCATGCGGGGCCAGATACTTGCTCACAGCGAGGTTAAGTCGGTGGCTTGCACACTCAGCAAGTGCAACGCATAGCTTA