Description :
From Genome Similarity Track
Location :
Scaffold_2:50476- 51494
Sequence
1018 bases(100 bases per row)
TCTTAACCCGTGTGTATGGTGGTGATGGCGAAGCGATGACTCCAGATTTAGCGTAAAACCTCTTTCTTCGTCGGGCTATCAGCGCCAACGCATGGACAGC
GTTCTTGAAGTCGTTGCAAGTTCTCGTCGCCTCAGGAATCAGCGAAATGCTCGCCTAGCGCTTCTGCTGTTTGTGATTCTTCGACGTACGCGGAGAGCGC
GGTAATCACGCCGGCGTGTTGATGTCGATCTTGAAATCGAGATGTTGCTGAATGAAAACATGTTTGAGCGCACCTTTCAACTGTCTGCAGAGAGCTTTTC
GCACCTATTGGGGCTCTTGACTCCTCGGCTTGAACTAGACGTCCAACAATCTGTCAACTCAAGCGGCGTGGCCCCGATATCGCCGGCAATGATGCTCATG
AGTACGCTACGCTACTTGGCAGGAGGATCATATCTTGATGTCCGCCGTACTGTTGGAATTAGTAGTCCTTCCTACTACCGTGTGATAGATTCTACTATGG
TAGCAATTCTTGCACTCCAGGAACTACGCATTGTGTTTCCAGAATCGGACTCGGAGAAGGAGGTCGTACTGGAAGACTTCAAGGCGATCACTGCGGGGGG
CGTGATGAATGGTTGCATCGGTTGTGTAGATGGGTAGCTCTGTGTAATTAAGTCGCCTACCGCTGCGGATGCTGGTGCTGTTGGCACGGGACGGTATTTC
AGCGGTCACTACTCGTGTTCTGGTATAAACGTGCAAGCGGTTTGTGACGCACACTGTCGCTTTACTGCTATCGACGCCAGTTTCCCAGGAAGCACAAACG
ATGCACGTGCATTTAGAGATACCAGTGTGGCCAGGATGCTCGGTTCGCTGCCTGCTGGAATGTACATCATAGGCGACAATGCTTATCCGGTGGGCGAGCA
TTTGCTTACACCATTTTCTCGCAACCAAATTGCAGATGAGTACCAATTTCCATGCAAGTCAACTTCGCATACGCATCGAAATGGCGTTTGGGCTTCTGAC
GACAAAGTGGAGGGTGTT