Description :
From Genome Similarity Track
Location :
scaffold_28:50475- 52738
Transcript NameFunction/comments
Plaha_PHALS_01605agc akt protein kinase

Sequence
2263 bases(100 bases per row)
TTGAGCTGCATAAAATCGTGCTCGTTTTTCCGAAAATTTTCGGGATTTTCGCAAATGGAAAAACAAGGAGCCACCATTGTAATAATCCATCACAAGATAC
AATTTGTCTTCATTCTGAAATGCATAGCGCAATCGCACGACAAAAGGATGATCAATATCTCGTAAAATTCGACGTTCAGATTTCGTATGTTCCACTTGAT
TTTTTGCAAACACGGAAGCTTTTTTCAACACTTTCATGGCATAAATGGCATTTGGATTCGATGCTCCATCGGGGACTTTCTTACGCACGAGCATCACTTT
TCCAAATGCGCCTTTTCCAATGACTTTAAGCAGATCAAAGTCTTCAACACTGAGTTTTGAATTCTGTGGCGGTTGAGCATTCGATTCTGATCGTCCTTGA
TTCGACATTTGCGTATCAGATCGATTACGAGCTTGCGACATATCCGTTGACAAGTTTGTCGCGGTGACAGcatcacttgccgttcgattAAGACGTGGAT
ATGTTGGAAGTGGCTGCGTCGGAGCTTGATTCGTACGTGGTCCCTCAGTCGCACACTCAGTACATACACGTTGTGCTGTACTGGAACCCGGTAGAAATAG
TCGATCTCGGGAACAAGCATTGCAAACTGCACGGTGGCACATTCGACAATGATGACGACGATCAAAGAGAGTAAAGTGAAAGAGACAGAGATTACAGTGT
TTTTCACTATTGCCCATTTTGGAATTGTTTGCCTCTCGTCGACTTGATTCTTGACGTTGTAATTGAGGAACAGTAGCATTTGTACCATTCCCACCAAGTA
CTGGAGCTGAACTTGGTGGTTCCGATACTGGTTTTTCACCCGCGACATATGTTGTAGCATCACGTGTATCTAAGAATCGAAAGAGTGCATCTTGGATCTT
ATTGATACAAAAAGCTGTCACATAGTAATGATTCGCATGCGCGCGTGGTGGTCGACCAGCAGATAAGCACGTACAACCAGTACGATGTGGTGCATCACCA
TCTAATTTTGTCTGAAACAATTGATCATTACTTTCCCAATACATTGTACGATGTGCCAAAATCGACTTGACAGATTGCGAATCACCATCTTCAATTCGAT
GACTTGATTCAATCAAAGCAATTGCACCATTTCGACGCATCAATTGATCTCCACGCGATTGAAGAAGGTATTTAATCAATACTCCTCCATACGAGTAACC
TAAGAAATACACTCGTCGTGCTCCCGATCGTGCAATGTAAGAATCCCAAAGAGAATCCATATGTTCTTCTGGACTTGATGAACCTGGAATTTGTACTCGT
TGTTTTCCATCTCGTAGAACAATGACATTTTTATTTGGATTTGCAACAATGATACCATAACCTTCATCAATGGCTTTACGAAAGTATTCAAGCATACTTC
CACTTTTCACACCAGCATGTAATACAAGACCACGACTCCATAAACCAGGATACAAGCCACGACTGACAGCTACAAAAACTAATAGTTTCTTACACGTCTC
GTAATTTCGAGAAACAAAGACATTAGCTTTCACAGGGGTATCCGATGTACTGGTTGCAGGAATAAATGCTTCTGTAAAACTTAATTCTTTTCGCATGGAA
TCTTGAACATATTTGACAACAGTATTAATGATTTCATCTTGATGAACTGCCAAGTCCGAGTCATCAAGACCTTTGCCCGTAGCTTTTAAATGAATCATTC
CTTCGTTATCCATTGCATAAAGTGGATGGGAAAATGGAAGAGCAGCTGCACGTTGACTTGATTGTTGATAATCTGCTGATGCAGGTGCCGGAGGAACATT
TCCATTTGATTGCCAAGATGGTTGTGCTTGGTAATCCGAACCGTTGCTATAGGTACGTCCAGGTGCAGATGGTGGACCACGCGGGACACCTGAAGTACCA
GTTGCTCCATTAGGATAATATTTGTTCCCAGCACCACTTGGGTCTTTGTTTTTATTCTTCTTTCGTCCCCATCGTGGAAATCGGAACGACATAATTGAGA
CTATCACTTAACCAATTAGTATAgaagagaaaaagaaaaggaaAGAAGGAGATGACGGTACCTTGTTAGTAGAGGAATTATCGATTGCAAGCTACGACAC
AAGACACGACAAATAGAAACGTCAGATTGCTTACTCCACGTATGTCGTTTCTACTTTCGTGAATGTTTTCTCTTTCAAGAGTACATAGCGCACGTACCCT
GTCACTGAGAAGGGGGATCGGCCTCTGCCGCGAGAGCGAACCCTTGTCACTGCTGTCGACCAG