Description :
From Genome Similarity Track
Location :
Scaffold_1365:5047- 8317
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1365-fgenesh-gene-0.0Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1365-fgenesh-gene-0.3Structural molecule/ transmembrane receptor

Sequence
3270 bases(100 bases per row)
GGATGGACGCTCGCAACGAACAACATGGGAGAGCGACATGACACGTCGGACGGGTCTTTCGTCACGGCCGCCAATGGGTTTTCAGTCGAACTTCAGAAGT
GGGCGAGAGCCTCTGGCGCCATGCTGTTGTGTCTTGGTGACTCGCGCTCTCTGCTGCTGCAGCCATCTGATCGCAGCTTGCGCCCTGTCCGCCAGTAATT
CAGGTCAACCTGAATTTGATCAACCTACAAAATGCTTGAAAGATTATTTTCAGCTTTCGCTGTTCTCGCAATGTGTTAAACGTGGCAGCTGAACCAACTC
GAAGGCACCGCGCTCACGCTGGTACACTACGGCACTGTACGCGTATTAATACACCCAGATATCCTCTTTCAGGTGTAACGCCGCAAGCCAGATTGCAGCC
TGACAACGCGAATGCGACGACACGTCTTCCGTCGCAACAACAGCAACCTGTGAGCTGGCCAAGGCCATCGCAGGCTCTCTTCCGGCACGACACGCATGGG
ACAAAGGAGCTGCGCGAACGATGGCATCCTCATCCTGATGTCGCTCGTCGAAGAGTCGCGATTATCCTGAAGAGTTCAGACACTGGCCACACAATTCATC
GATCAAGCCAAACGACATTGCAATGTTTTGGCAACAGCGTAATCTATCGATCAGCTGATCCTATTCGAGATGATCAAAGCCAAAAGTTCAGAAACAATAT
ATAATTGGCTGAAAATGGATTTCAAAAACGCTTTATGCAAGATATGATTGGCTGAAAAAAGAATTTTCAAAGTCGACAGTTTTATAGAGACAACCTATGC
TACAACCTATGCTACAGGATGCAAACAAGAAGGCTGCAACAATGACTGGAATCCAAAGACGTCACTCTGGCTAGATCCCGTTTGAAAAACGTAAGCATCC
TCGCCAATGTGTTTGCGCGTGCACCAAGTGCCCAGAATATGGCGACTTTTCCGAGGGCATAATCGCAAAAATGGTAGCCACTGTGAACATCGCAACCTAT
AAAAACAACATCAAACATGTCTCTCGCAACCTACAAATACAGCATGTCTACCTCTGAAATTTAATATTTGCAGCATCATCAAGCTCTCCCACACAACAAC
AACAGTAAACTGGATAGTTGCAGAGTGATGGTCCATATTTACAAAGTTTCACAGGGATTCCGAATCTTTTGTTCACACGGAACACAACGACAACACACGC
AAAGAGCTCATTTCCGAAAAGCAACGCGTCCGGCACCAGCACCAGCAGCTCCTTGTCTCTCTCGTTCTCTCTCTCTCTCCACGATGAACTACTTCTTTGG
TGAATCCGCCCCGGCGCCAGAGCCCGTCGCCTTCGGCAGCAAGGTGTACAAGAGCGCGGAGGACGTGGACATCAAGGCCTTCGGCAAGGAGAACGTGCAG
ATCCTGTTGAACCGCCACTCGGGCGAGGACCGCGTGACGACGTGGGAGCTCGTAGACTCGCAGGTCGAGGGCCACGTCAAGATCTGGCGCGGCGAGGTGC
AGGGCAGCTCGTGGAGTCCATTCAAGGCCTCGCGCCGCATCTCGGCCGACAAGGTGACGGTTCAGAAGGCGCTCACGGACCCCAAGCTGCTGCTCAAGCT
CGACGACATGACCGACAGCGTGCGCATCCTCAAGAGCCTCGACGACGAAGGAAAGCTCAGTCTGCGTTACATTGTGAGCAAGGGCGTCTTCCCCGTCGCG
GCGCGCGACTTCGTCATCGTCACGTACGCGACGTCGCTCCCGGACGGCTCGCTCATCATTGCGAGTCGCTCAATTGCGCTCTCGGAAGGCACGCCCGTGA
CGGACGGCGCCGTGCGCGGGGTCAACGAGGTCTCGGGCTACATCATCCAGGAACTCGTGGACGCGAACGGCAAGCCGTACTGCGAAGTGACGCTGCTCGC
GCACGCCGACCTCCAGGGGTTTATCCCGGCGCCCGTCGTCAACATGCTCGGCACGTCCGCGACCGTCAAGATCCTCGCCAACCTCGAGACGATCGTGGGC
AAAATGTGAGCGCGCTTTCGGTAACAACAACATCAGAGAACGAGATAGAAACACACATACATAATCGATAGGACACTTTTCATTCACGTGCATAGGCTTT
ACGAATTTAATTGGCATTCAAATTTTAACCATGGCGCTATGGAATTTTTGCTTGCATGAGGCATGGCTGCAGCTTTGACGAGAGAGGCGCATATTCATTC
TCAATAATTAATCTTAAGAAGCATGATTCGATCTCTTAGCTTGGTGCCGAGATTCTCGGCAGAGACGTCGGTGTATAAAATGCATGGTCCTAGCACCACA
TGTCGTGGTCGGCCTGGTTGTTCTTGGCCTGAAGGTTCATCAGGTTCTTCTTGGTGAGCGGGGGGTCGGCGATGCGGCAGTTCAGCATGGCCTTGTCGCG
ACAGCTCGGAGCGGCGCTGTCCCAGACCCGCACGAGGTCGTGTTTGCGCACCTGTTCGTCCAGGCTGAGCAGCTCCTGGTAGACGGCGATGTCGACGCGC
ACGATCTCGACCATGAAGCGGTCCTTCTCCTCGCGCTGCGCTAACTCGGTCAGCGTGGCGGCGTCGTCCGGGACGAGCATCGAGTCCTGGCTCACGGGCA
GGATCTCGATCGGCTGCGCGTTCGACGGGCCAATGAGTCCCCGGCTGGGCTTGACAAAGTAGCCTTCGTGGTTGGTCGTCTTCACTTTGAACGCCAGCGC
ATGGGAGCGCGACTTGTTGGTGAGGAAGAACGTCGCCGGGTTGAGAGTTGTCGACCCCGGCTCGGAGCTCACGGTGAACTCGACTGTGTCGCTCGGATGG
ATGCTGAAGAGCGCCTTTGTTGGAGCGCTCTTCGCTTGAGGCGCCTTAGTGGTTGGGTTGTTGTCGCCGTTGTCAGTGATCTGTGAGAAGAGAGTTCGAA
TACGGCATTGTCAGTAGGGTGCATCTGTGCTTGTAACTAAAATAACAAAGTGCCGATTCGTACCTCGGAACTGGAGCTGGACTCGAAGGCGACGGGCTTC
TCTTGTTCACTGCTGCTTCGCCGCCGATGCGCATCACGAACGTCGATCGTTCTGTCAATGTCTCGTATCTGCACCGCCGAGAGCCGTTGATCATCGGGCG
TCTGCTCTGGTTCAGCAGGCAGCGGCACTAGTTGCTTGCGTATCGCCGGTTGTGGGCTCTTGGAGATCGTGTCCATACGGAGCACAAGCGGGGCCGCACT
GGCACAGCCGCCGCTCGGCAGCATGGCGAATCTGCAGCCGATCTTACTATTCGAGGCGAGCTCTCGGGGC