Description :
From Genome Similarity Track
Location :
contig_115:50469- 54932
Transcript NameFunction/comments
g13283.t1hypothetical protein

Sequence
4463 bases(100 bases per row)
GAGCCGCTCCCATCGCCCAACGCGTGCGGAGGGTGGCCCCTCAATTCCGAGAGAAACTGTCTGATCTGATCAAGAGTTTGTTGTCCGCGAAAATGATTGA
GCCATCAACTTCACCATGGGCATCCCCGATCGTGATCATCATCAAGAAGAATGGAGTCGACATCCGGCTGTGCATCGACTACCGTTTGGTGAATAGCCTG
ACCAGGTTGATGGTATATCCCATGCCGCTGATCAACGATCTCTTGGAGGACTTGGACAAAGTACTCTGGTACTGCTCTTTGGATATGGCTAGTGGTTTTT
GGGTGGTCTCCATGACGGAACGTGCGCGAAAGATCTCCGCGTTCGTTACGCCTTTCGGACTCTTCGAGTGGACGCGTATGCCCTTCGGGTTGAAGAACGC
CCCACAAATCTACCAGAGGCTGATCGATAATGCTCTGTACGGATACCTCCGGATAAGTCCTGATCGAGACCACACGGAACCAGCCGACGTGTTCGAGAAA
GGGGAACCCGAGGCACACCCGGGTCCTTCGGTGCTGGGCAGGCGATCGTACATCGACGATATCCTGATCACCGCTGACACCTGGGACTCGATCTGCGAGA
CGGGTCGAGGCATTGCTTGACGCTTGCGAGCGATGGAATCTGTCGATCAGCGTGGTTAAGAGTTTCTGGGGACATCGGAAGGTAGAGTACTTGGGTCATC
GGGTATCGGCCGATGGTTTGGAAGCCAATCCGAAAGATCTGGAATCGCTGGAGAAGCTGCCGTTTCCGAAGACGTTGCGATCGATGCAGTCCTTCTTAGG
AAGCCTGAATTATTACAGTCGCTTCATTGAAGACTTCGCCGTTTACGCTGCGATCTTATACGAACTGCGAGAAGTGGACTTCTACGAGATGCACCACGGG
AAGCATGAGGACCGAGCAGCGGAGTCCGACGATCGGTGGACTAGAGCGAGGACGGCGTTCGACCTACTGAAGGCCAAGCTTGCGACCACCCCGATTTTGC
GACACTTCGATTCCGATCGCCAGCCTGTGATCGTGGTCTACGCCAACAAGTGGGCTATCTCAGCTGCGTTGGTTCAGGAACATGATGGCATGTATTGGCC
TGTGATCTTTACCAGTCGTACGCTGAAGTCGAACGAGTTGAATTACAGCATAGTGGACAAGGAAGTTTTGGCGCTCCTCCGGATCTTGGACGTGTGTTAC
ACAGTCCTGACCAACCGATCGATCAAGGTGCTGTCGAGGTATTCGACGCTCGCCTGGTTGCTGAATGCGTCGGGCTTCCAGGGACGATTGGGACGATGGG
CAGCTCTGCTGTCCGAGTGGACCTTGGAAATCAGGAAGTGCTTGAAAGGAGAGGACGAAATCCTGGGCGCGATCGCCGCCAGCATTACACCCCGAGCGGA
AGTGGACGAGGCCTTGATCGCGATTGCACCGGTGAAAGAGCCCAAACGAACGATCGCGATGGCGCCGCCGACGGTAGAGCTGGATGAAGAGTTGCTCGTC
GTCAGTTTTGATGGGTCAGCACGCGTCAAGCGGAGCGCCGGAGCGTATAGTGCAATTGTCTGGAAGCTCCCGGAGTGGTCGATCACATCTGCCGCGTCCG
AATTCGCCGACGACCTGACTGTCAACGAAGCCGAATATCGCGGACTTCTGCTAGGCTTCAAATTACTGTCCGATCAGAACAGGGGGCGAGTTGTGATCTG
CGGAGATGCCAATCTGATCATCCGACAGATGCGTGGTGAAATCGATTGCAAGGCACCGGGTCTCCAGATACTACGTCAGAAAGCGATGGATCAAGTGAAA
GCCTGGCCGAAGCACGAATTCCTCCATGTGAAGCGCGATTGGAATCAGAGCGCCGATCGGTTGGCAAGTGCGGCACTGCAACGAGAAGCAGGCGTGATCG
TAACTGATGCAAGAAGAGATCGTCCAACGCATGAGGAGTGAGAGGTTAGTACAAGCCCAGGATGAAGAGAAGTGTATCGTGGACCTGAAGTCGTACCGGC
GGGGCGACGTAGCAGCCTTGACTACCAGGGATGCAAAAGCGTGCGCCAAGATCGCTGGAGATTACGAAGTGGGGGAAGACGGCCTGCTGTTCTACTGTGT
GAACACCACCCGGTTAGACGAGGACCGAGATTCGATCGCGCGTCTGGTGGTACCTGCAACGTTACACCAAGATTTCCTTCACCATTATCATGCCAGCCTT
GAAGGAGGGCACCAGGGAATCGGGAGGACGTACCAACGGATCAAAGCGCACTTCCACTGGCGGGGGCTGTTCAAGAGTGTCCAGCAGTTTGTGGGTGAAT
GCGTGGATTGCGAGACAGGGAAGAGGCGCCCCGTGGTTCAAGGAGAATCACCTGGGAATGTACGGGCCACCCACCCCTTCCAAATCATCGCGATGGACAA
TCCCATCTCTGCCAAAATCGTTCAAGGGCAACACGGAGCTTCTCGTGTGGGTCGATCTGTTCTCAGGGTACGTGATCGCTAAGGCCGGCGCGTCTCGGAC
AGCGCAGACCATCGCGGAGAACTACGAGGAATGCGTTTTCCGCCGCTTCGGAGCCAGTGAAGCGATCCGACATGATCGGGAGCCCGGTTTTATGTCTGAT
TTCTTCCGCGCATTCTGCCGTATAGTGGGAAACGACAACGAGCCACCATGGCCTATCGACCACAGGCAAAACGGTACCGCTGAGCGATGGTGCAAACGCT
TACTCGCGCTTTGAAGATGTATGTCGCCGATGTGAACCAACAAGACTGGGACGAATACGCGGAACGCCTGACTTTCGCGATCAACACTGCTCACGATCGA
GTACGAGGAGAGGACGCCGTTTTACCTTGTCCATGGCTGGACCCACGATCGACCTTGGAAGCGTCGCTACCGTTTGGCAGCACGCGACGTCGCGATCGCG
ACCCGCGCAGATGGAGATATCGTATCCAGCAACAGTACCAGCGAGCTCGCGAGGAGGTCAACGCGCGCCTGAAGGAGGCGATCCAAACGAGAGCCGATCG
CCACAACGACGGGATAAGGCCGCACCAGATTGAGGCCGGTCACAAGTGTGGCTATATTTGGATCGAGTTAAGGAGGGCTATGCCCGAAAGCTGGCACACA
TGTGGCAGGACCGTTCCGGGTGCGCGAGATGATTGGCCCTACGCGGCCCGGCTAGAGGTGGCCGGCACAGAGTATCGTCTTTTTCCAATTGTACACGTCT
CGAAGCTCAAGGCCGTGAAGGTTTTCTCTGATCGCCCTGACGTGACGCTAGCAACGGACGAGAATGGTCGATTTGATTTTGATGAGGCGTTGTTACCGGA
GGACAGCTGGGAAGGTGATCGGAGTGATGACGAGTTTGAAGTGGAGCGATCACAGATGTCCGATCGGGCCGTAGACCAGATATGACGCGTCCATCGGGAA
TTCCAGGTCTTCTGGAAGGGGTACACCGAACGTCTTGGGTCGACGAGGCTGACTCAACTGCGGGCTTTGATGCACGAGTTTGAGCGCGAGCGTACTAGAC
GGAATGGCTTCGGAGTGATGCAATCGCACGAGGCAGAGGAGGACAACTCGTAGTGATCGCTGCGAGTTGGGAGTGAAATGGGTGCAGGGTGGCTGCACTT
AGGAGAAGGAGGGCAACTCGTGGCGATCGCTGCGAGTTGAGAGTGAATTGGGTGCAGGGCGGCTGCACTCAGAAAGAAAGGAGGTATATGTACAAAAAAC
AAGTGGCGTGAAGGGGAGAGAACCGATTACGAGGTTCGATCGACCCGATCAAGGAAGACAACTGGAGAAAAGAGGTGAAAATGGAATTACATGCAGACTA
ACACTCAAGTGTACGCTTAAGGGGAAGCTGGGATGACGAATTTGCTACGAAGACGCGTAATGCGTTGCGCGGGATGCGATCGGATGTCGTGGCGGTATTG
GACTCGCCAGGGCTCAGCCAAGTCCGCCTCTTGGACTGCGGTGATCAGATTCGTCGCCTGCGAGTTGCCATGCTGCCCTGGATACCACATCTTCTCCTCC
ACCCGGCCGAGGTCGGTGCATGAAGAAAGGATCGAGCAGAATGTCCAAATCACACCGACCCTCAACCAGTCCACGCAAGATCGTCCGAAGAAAAACTCCA
GCGAGCACCGAATCGTGATTGCCGCTGTTTTCGGTAGCGGCGAGAGTATCCAGGTAAACGTCCCCGCGACGACTGCTGGTGCTGATGGAGAAGTAGTGCA
ACGACTCCCACACGGCCTGTGCATGCTCGTGTATCAGGTCCGCATATTGACGAGCCATGGTTGCAAACCAACCCACGAGCACGAACGAAATCGGGGTGAC
GACAGTGTGGGGAGTCTCCCAGGGGCGCGTCGCGTACAACGCCCGGACGTGAGCCGCGGTGATCAGATCTGACCGCCAAGCATGATCACGTGGAGCACGA
GCTGCACGCTCAGGAATCAACCAATTACGTGGCCGACAGAAGTGATGGAACAGCAAGTCCAAA