Description :
From Genome Similarity Track
Location :
Scaffold_492:5046- 6219
Sequence
1173 bases(100 bases per row)
GGTGATAAGATCTAAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTACATGGCAGTTCAATCGTGTATGCGTTGCCTAGCGGCGCAGTACACGA
AATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCATGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTAGATAGTAGGACTAGGTTACCTTCAT
TGAATGAAAGAACATTTGCCGTTCCATTCTTGTCTACGTTTTTCTTTTGTCGGTCCACTGCTTCAGCAATGGAATCTTGCACGAAACGGACAACCGTTTC
GCGAGCCAGTATAAATTCATTCGCTGACTCGCTGTCTTTAGCTGTAGTGCGCTTGGAGCTCACTGTGGCAAGATCAGTGACCTGGGTAGTAAGAGCATCC
TCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGTGTCATACGTAGTGACTTCGTGGTCAGTACGTGATGAGTGAGAGCCGAGTT
GGCATTCGCTCGAATGATTCCCTCTGCCCTCAAACTAGACTTATACTCTAAGAACGTGAATAGGCGTGGGTGGCGCAAGCCATTCACGAAGAACGGTGTA
TGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCAAATTCCACCATTGGCGAGAATTCGCTCCAATTCTTAAACAAATGGACATAACCCCTAAGGATTT
CCTCAAGAATGCGGTTTGCACGTTCTGTCTGACCGTCTGTTTCAGGATGGTCAGAGGTCGACATCTGAAGGCACGTTCCGGGTGTTTTGAACACGGATCG
CTAGAATTCTGCAGTAAATCGTGGGTCTCGATCACGTTCAAGAATACCTGTATTCTTATGTGGGTCTGCGGGGAATCCAACGACAAAGTCCATTGAGACT
GATTCCCAGCATTCTGCCGGAATAGGCAAGGGTTGCAACGGCGCACGAAGTGAAGGACCAGACTTCACTCGTTGACATACTTCGCATGCGCGGACGTACT
TTCGCACGAGTTGATACTGGCGGGGCCAGTAAAAGTCACGACTAACTGTGAGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCATCGTGGTA
CTCATACATGATGTGCAGTCGCAGGTCACCATGGTCCGGTACGACGACACGAGGCGTGTCGCCGGCAACGGCT