Description :
From Genome Similarity Track
Location :
scaffold_966:5045- 6889
Transcript NameFunction/comments
Pl_101717heat shock 70 kDa protein
Pl_101718hypothetical protein PHYSODRAFT_524789

Sequence
1844 bases(100 bases per row)
GTACATCTTCTGCAGGATCGGGTTGGCAACACCCTCAAGCTCCTTCTGCTTGCCCTCATACTCCTCCTTCTCGGCAGACTGGTTGGCGTCCAGCCAGTTA
ATGGTCTCGGTGCGCGTCCAGCCACTGGATCACCTCCGTCACCTTGTCGTCCACCACCTTCTTGTCGGCCTCTGGGATCTTCTCCTTCAGCTTCTCGTCG
TTCAGGCTGTTACGCAGACTGTACGCGTAGTTCTCCAGCGCGTTCTTTCGCCTCGATGCGAACCTTGTTGGCTTCGTCCTCCGACTTGTATTTCTCGGCC
TCCGCTACCATGCGGTCAATGTCGGCCTGCGAGAGGCGACCCTTGTCGTTCGTGATCGTGATCTTGTTCTCCTTGCCTGTTGACTTCTCCACGGCCGACA
CGTTCAGGATGCCGTTCGCGTCAATGTCGAACGTCACATCGATCTGCGGCACGCCACGAGGCATGGGCGGGATGCCGTCCAGATTGAACTTGCCCAGCAG
GTTGTTGTCGCGCGTCATCGAGCGTTCGCCCTCGAACACCTGGATAAGCACACCAGGCTGGTTGTCCGCGTACGTCGAGAACGTCTGTGACTTCTTGGTG
GGAACCGTCGTGTTGCGCGCGATCAGCGTGGTCATGACACCACCGGCTGTCTCCAGACCCAGCGACAGCGGAGTCACATCCAGAAGCAGCAGGTCCTGCA
GCTTCTCCGACGAATCGTTTCCGCTCAGGATGGCCGCCTGGACGGTAGCACCGTACGCCACAGCCTCATCGGGGTTGATTGACTTGTTGGGCTCCTTGCC
ATTGAAGAAGTCCGACAGCAGCTGCTGCACCTTCGGGATACGCGTCGACCCGCCTACCAGCACAACTTCGTGTACCTGACTCTTCGACAGCTTAGCATCA
CGGAGAACCTTCTCGACAGGTTCCATCGTCTTGCGGAAGTAGTCACCGCACATGTCCTCGAAGCGCGCGCGTGTGATAGTCGAGTTGAAGTCGATACCAT
CGAACAGGGAGTCAATCTCGATGTACGCCTGCGCCGATGACGAAAGTGTACGCTTGGCACGTTCGCAGGCAGTCCGCAGACGGCGAAGCGCGCGTTGGTT
CTCCGTGATGTCCTTGCGGTGTTTGCGCTTGAACTCCTGCGTGAAGTGGTCCACCAGACGGTTGTCAAAGTCTTCACCGCCGAGGTGTGTGTCACCCGCC
GTAGCCTTCACCTCAAAAATGCCTTCCTCGATGCTCAGCAGCGACACATCGAAGGTGCCGCCACCCAGGTCGAAGATCAGCACATTGCGTTCACCGCCCT
TCTTGTCAAGGCCGTACGCAATAGCAGCAGCCGTCGGCTCGTTGATGATACGGAGCACATTCAGACCAGCGATAGCGCCGGCGTCCTTGGTAGCCTGACG
CTGTGAGTCGTTGAAGTAGGCAGGCACCGTGATGACGGCGTTCTTGACCTCCTTGCCGATAAAAGCCTCTGCCACCTCGCGCATCTTGATCAACACCATG
GACGAGATCTCCTCGGGTTGGAACGTCTTCGACTCGCCCTTGAACTGCACCGTGATCTGTGGTTTGTCACCGGCACCCGACGTCAACTTGAACGGCCAGT
GCTTGATGTCTGCCTGTACGATAGGGTCCGAGAACTTGCGACCGATGAGGCGCTTGGCGTCGAACACCGTGTTGTGTGCGTTCATGGCCACCTGGTTCTT
GGCAGCGTCGCCGATGAGGCGCTCCGAGTCCGTGAAGGCCACGTACGACGGTGTGGTGCGGTTTCCCTGGTCATTAGCGATGATCTCCACGCGGTCGTTC
TGCCACACGCCGACGCACGAGTAGGTCGTGCCTAGGTCAATGCC