Description :
From Genome Similarity Track
Location :
Scaffold_10:50438- 52265
Transcript NameFunction/comments
Phyca_LT1534504842Crinkler (CRN) family protein

Sequence
1827 bases(100 bases per row)
tccaccgcattggactcgccgctatgaccgaaaagacgacaaaacgagtccacaaagacgctcccgaagccgatattatcaaggcgctgaagacgtggca
aagccatcgcgagcagtgggggtctatggaagcttcgcgaaagcttggctacccgaagggaactttgatcggctggagaatcaagtactcagaccgcacc
taagcaaggaccctgtcccacttcgaccggccaaccgcttgcgagcaccaggaggtgggcggaagcacaagtccctggaatggggaggttcagttcgtga
atactacgcgaaatctcctcgacaagacgaacgggtcagcaatgcagatattctggcaaattgccgcaccaagaaggagtttaaagtcaagtcaaaggat
gcacaggctgtttgggtaagctgtttcattccgcacaccaagaaatcgcaaattacagctgcttgcatatcagaagctgacgctcaggctcctgttgcaa
cgcccaacgaagcccccaccaatacccccgagtcatccacggcagaaaccgttcgaatgtacgacgtccctgatggtggcccggatgacgcccgtgatgg
cccagatggcgcttgtgacgacggcccagatggcggaccagatgacggtccggacgaggcctcagttgatactccccattttcctgcggcagcggccatt
acgtctgacgtcgctcccgacgacgatgctcatgacggcgtcctgaatgatactccacccgatggtcgtaggcgtttatcatctgcacccgaccatgacg
caccgatggtcaccactccgaagagtgataattcagcgctgcaacccaggaagcgttattctcttcgtgatcgcggtacttcagctaaattcctcttccg
gtatccaaacgaagagagatcaagctctccgtcacgtatcacggttgctgtttatccatccgaccttttttctgttgagccgtgccagccattaacaggt
tcggtgattgatttgtgatttacaagcgcattgctcgaggaaaaggttttgcatatccatttggcagctcactatttgttcagatagagcacgtgcacca
gtcaactaaatcattctctgctgccaaggagttggtggacaaagtagaatggggttgttgtccattcgtgcttatacctgttgcagcggtggagcactgg
agcctcctaatagtggagcatcctctctctgatcgagtacagtgctatcacgtcgactcagtggcagcgaagcaccagtcgcagtacgtttttgatgtgg
ccaagctcttcttggaagcgatcagtggtcattctgcagtgatggagggattagcgttgacgatgcaacctgaacagcgaaactactacgattgtggtgt
gtacatgttggactgcatgaataagattgcccagaatatcgttcaaaactcaccgaagactctgatgaacgacattcgcaagttgacgagcaagtgtaca
gcctctaaggctgataattttcgagcctctatgcgtgagaagttccagaagagattgcaggatgcctgacgaacgccttaggaagtaatgcagtttggaa
gacagtatgcattaaattgttaatcaagttggtgtcgggcactggacgtcattggatgtgccccccccccccccaccccgcccgggctgttgtatgtctc
ccattcgtaacttgtgagccctttgaagctatcattgtcccattgtgtaggtgtagatgtccatggccttcgaaaccactggtgaacgtgttgttgccct
tgcccttaatttcgccttcaccgcagg