Description :
From Genome Similarity Track
Location :
scaffold_157:50432- 51462
Sequence
1030 bases(100 bases per row)
TGGAGAAATAAAAACAAAATATCTAGCTCAATCACACACTTCTGTCTCAGTCTGGGTTGAGTATGCTGTGGCTGTTGGAATAGAGTAAGGACCCGAGCAG
CGTGATTAAAGAAGACTTGGTTGTAGGCGAAGTAGAAGATTTGAACAAGAAAAAGTAAAGTTTATTGTCGTTTGAGTTTGAGTGGGAAAATGTACGAATG
AATGAAACTAAAAGAAGTTCAACACCAGCCAAGAACACTCATGAGCATGACACCTCTTCCTGTATATCGACCTAGTTGCTTGGACGTGACCTCTGTCCTC
CAACCTCACTCCCACCTCCAATTACCTTGCCAACACGACAAACCACACGACTTCTTCCACGGATGCTCCACGGCAGCCATCCCCCTCGACTCATCAACTA
CGCTAACTGTTCCTAGTGTACCCATGGGACGGTCAAGCATGTATGGAACTCAGATCCATGTTTTCTCGCGCATATGGAACTCAACCGCGATTCCGTATTT
TCAAGGGGGAAGTGCTTGAAATCGCGTGGATATAAAGGTATTATTACCATCAGATTGATGGGGACGTTCAAGACACCAAGCTGGGAAGGAAGACAGGAAG
ACGCAAGTTGCCTTGGTTTGATGTATTGGCGGGAACTACCTAAGGCGGTGGCTTGCTGGTTATGTTCCTGCTGGAGTAATTGGGAGTGAGCACCATGTTG
CGCTGCAACATGAGGTCGGACTCTTTTCTACATTGCGTTGACTACTAACAGCTTGTGCTATGTCTTGCTTCTGATGATGACTGAAGTTATCGCTGCGACT
AGCAGTTGCAACCGCTGCCGTTCATGGGAACGAGAGGTAGCAGCCTCTCGATGTCGCAGCAGGCGTTTCTGTTGGTACTTCAACTGAGATCGTGGTACTC
CACGCCGTTGTTTACTGCTGCATATTGTCCCGTGTTGCTACACGTTGTAATTTATCGTACTTTAGCGCATATCGGTACATTCTGTAAACGCAAGACTTCA
CAATAGATTTATCTGAACATCTGGGTAGTT