Description :
From Genome Similarity Track
Location :
Scaffold_14:50427- 51960
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_14-abinit-gene-0.67Conserved gene of unknown function

Sequence
1533 bases(100 bases per row)
CGATATGCCTCTGGAGGTCTTGACGCTTTTGACTCCAACTACGGGTTCCCTGTCATGTATCCGCATCGTGCGCGATCTGATCTTCGGCACGTTGCTACTA
GTTGGCACTTTTTAGCATGTTGATTATCTTATGATACGTAGGACTTTGATCCTCCCTTTTCGTCCACATCCCATATTTCCGAGTCAGATTCAGATTGCGG
GAGGCTCGCCATGCCATATTGATGACACCTCCTCGGTCGTGCGTGCTGGGAACAAGCAGCGAGCCCGTTGGGAACCAGCAGTCAGTCGCACACGTCACTA
CTGGACGCTGACGCCAGAAACAGTCATCATAAAATGAGCACGAGCCCTCTCGCACAAACCACACAAATCAAAACTTTCACCAAGCGGAAAACCACACGGT
TGCACGTGGGACACACAATACAACAGCGCCATCTGGCTCGCTGTCTCTTGCCGATTATGATCTCCATTATTGGAAAGCAACCGCTTCCTCTCTCACATCA
TCCCGCTGCGTTGCCCGATCCTGAAAAGCCGCAACAATTTGTGCGCAACGGAGCGCAATCACGCTGTCCCCGCAGATGTCGACTTACCAGCGCGATCACA
ATGCTGATGCTGCAGAATCCAGAATCCAGGATCCAATCAGAGGCAGGCATTTGTCGAAGGGAAATTTGCTGCCGTGCATCCCAACGTTGGTCTCTCAGTG
GACACCAGAAGCTACTTCTTGCAGGACGCATCTCGCGCGATCGTACTACAACATCCGTGTTCATGCAGCTAGTGAACCTTTGACTGCGGCTTGTTTGAAT
GAATGGCCAGATGAAAAACCAACCTGATCGCCCAGTCGCCGATTGGAGCTTAACCAACGCAATTACTAGAGCGATGATTCTGGGCGACTCTGGACGAGTT
CGAGGTGCGCGTACAGTTTGAGTTTCAACTTTGACCTTTCTTCATCCCCCTTGTGTGCACAACTCTCTCATTCTCTCTGGACTTTCGATCCAGCCCTTTT
GCCATAGCAGACTCTTCATCATATGCCATCTCGCGTATCGACACACATACATCACTAAATACAAACGGGGGAAGATACTTCTTCAAACTCGACGTTTACC
GCATTTGCTTGTGAAACTTGATCACTTCGTCTACATCGAAGCGCAAGTGGTCGAGGCTCTCTGTTGAATGTAGAACACGAGAAAAAGACAAGATTAAGAT
GTCAGAAACAACAGTGGCCATGAAACAAAAGAGAGCAAACTCACCAGGTAACGAGAAGCGGAATCGCGTCTGAAAATGCGTGTGGCACACACAGCTGCAC
GACTGGCAACCTCCGCAATATGAGCACGGTAGCGACGGCGAGCACGAGCACTCGAAGTAGTTGGGGTCCAGAACCGATTGTGGCGCGCCAGTGTGGCCCT
CGTAGCTCAGCAGTTTGCCAAAGTACCCGTGGATCAGTCGTGGCTTGAAGTGGTGGTGCTTCGGATGTGCGTGGCAGCGAAGGCAGATTCGGAACACCTT
GTAGCTCATGTTGGGATGGCATGTGCTGGCATA