Description :
From Genome Similarity Track
Location :
scaffold_11:504211- 505927
Transcript NameFunction/comments
g12928.t1 ribosome biogenesis ATPase RIX7

Sequence
1716 bases(100 bases per row)
CTTTCCGAGAAGCGTTTGGCGCCCTTGGGATTCCCATGCTGGTCACCCTTGTGGTGTGCATTATGTGGACAACATGGCTCGTTATCATAGCGTTGGCACC
CAACGAAGCTGCGAATTGGTTGATGGGCACAGGCGCCTACGACGACGGCCAGTTCTGGTTGATCATCGACACAAACTCCACCATTATTAACATCGGGGCA
GTCGGACTTGTTCTTGTTGATGCATGCTACCTGTACGTTGTCGTGAAGATACTTCGCTGGCGTAAAACAGTTGATGATGCACAGCGGGTTGCTTCGTGGT
TCGAACCAGAGTCATGTGTTGCTTCGTTCCCGTACACATGGATGAATACAGCTCTTACTCGATGCAGAAACTACTACAAGGATTTAACATCCTTTCGAGG
CAGCAATCGAAAGTTTTGGGTACGATTGTCTTGCAGGTATTTCCACAAAAAGACTAACCGATCATGCTATAGAATATGTGCTTGAAAGTTTTCAATTTGA
CTATGCAGATGACGGTCCTTCTTGAGCTACTGGATAGTGGTAGCCCAGCAACTCTCGTGTATGGTTATACGGCTTTTATTTCGATAGGTTCCTTGGCAGG
GGCTGTAAAAATTATCTACGGCGAATTTACGGCGATGGGAGAGGTTGTCGCCGGGTCCATGTGAGCGCTTCACAGTGTGCATTCTTTAAATTCCATCGCG
TTCTTGCTTGAATTGCTAACGCTAACACTCGATCTCTTTTGCGCAGTTTTGATTTGTTTGCAGCTATCGTTTATCCGGTGCTAGTGCTCGAGTACTGCTA
TTACAACTTCCAGCTTGACGATGCCGTTTTTGCTACATACTTAGCGATTCTTCCCCCGGGGAGCTTTGAACGAACGGCTAGGGTGTTTGCAGATGCGTCC
GAAATCGCTCTTTTCCGCGTGAATTTCGACTCTCTTCGAATACGGTCCCCTCTTGATTTCGTCCTACACACTAGCATTAACCTTTCGTTTTGCTACCGAA
TCAAGCGCATCGGGGATATTCTCGTTTCATCTCACCTCCGGCGTCTACAGTCAGTTAGAATGCAAAGGCCCAAGCCGGCAAGAAATCGCCAGAAGTCGGT
TCCGAGAGTATTCGCGAGTGCGTTTATTGCATTTAGTATCTTTGTATGGGTCTATTCCATCCAAGCTATCGAAGGCTCGCGCAAGTATTGCTCACCGTAT
CCGGAGTGTGTCGTGTATGCCTACCGCTGGGGATCTAGCGGAGGGGTGTGCCCCTGCCGAATTCTCATTGATATCGACCCCTCTCCTCAAACATACAACG
AATGGACTCACCCTGTTGACGTATATACTAACGTCCAAGCACTGGCGGTGTCCGGAGAGCTAAGGTCTCTTCAACTCACTAACCGCCAGCTTTTGGAATT
ACCTGAAGAGCTTCGAGCTTGTCGCCGCCTAACGTCCATGTATGTTGTATGTTGCTTCTAGACTTGGGCTGTGGTAATTTATATACTAATGATGTACCTG
TGGTGAATAGCCGATTAATTTACACCAGCATCCAGTCCATTCCGTCTTGGACAAAAGAGTTCAAGTACCTTGAGAACCTGTGCGTTCGTCAAGTTATCCT
GTGGGGTGAGATGCGATTTCTCACACATTTTTTTGCTGTAGTCATTTGGAAGGGAAGCAAGGAAGTCCAAATCTTGTGGCGCTCCCAGAAGACCTGTTCA
GCGATATGCCGTGGCT