Description :
From Genome Similarity Track
Location :
Scaffold_2:504174- 508553
Transcript NameFunction/comments
g1445.t1hypothetical protein

Sequence
4379 bases(100 bases per row)
TACGAATACGCCCGACTGCCGCCTCCTGTACCAGGCGGACACTGGTAATCCTGCGGCAGCATGTAGTTCTGCAGCGCACTGAAGCAATACTGTGCCTTGC
CAATGTTCTTCCGTGCATTCTCGCGCCGGACCCCGTATGTGCGAAGCAAGTTGGTGAACGCTTCCCCATCATCTGCAAGGAGTCCGTGGGAGCGCACAAG
AAGGTTGGCTTCTTCGAGCGTGATCGACATCGAAGTGCGATCTTTGGCCGATTTGCACATCGTCACTCGACCGCCGCCAACGGAGCGCGCAATGGACGAC
GACAAACTCAGGATAGACATACGCTTGGATCGCCCTGATAGCTGAATGCCGACCTTGAGAGCCATGAGAGACGTTTGAATCCGATCTAGGTCCTCCGCAT
CGTAAATGGCAGCTGATTCCTCATCTCTGCTCTGTTTCTTGGACACCCATTCAGCAAACCTGTCCACATACGCCTCCAGCTCGACCACGTTCTCTGCGTT
TATCTCCTTTTGTAAAGAAGACTTGCCAACAGTATTAGCGACCGTCTGCATTTCATTCAGCCCTTGTGAAAAGATCACTGGCACCACGCAGATGGGTTTC
TGGAAAATAAACTTGGCGCGCATCTTCTGCTCCGGCGTTGATAGCGGCAAATAAATTGCCCCTGAGATCGCGTCCTGGCCCGGAACCCGGTGCATGCTCC
GATCCGGAAACTCGCTCCCACGACGCGTGATGATAGGGAGCTCGATCACGATACCCGATGGCCCAGAAGTGATTGAGACGCGAAAAGAAGCAGCGCGTGG
TGACTTCACAGGTCTCAGCTTGATGTGGATACGTCCGAGCTCCTTTACGGCAGCTTCCGTGTCGCCCAACATCCCCAACTCGTTGCCATATGTAGAGAGT
AAGCTTTCCACCGAAAACAAGAAGCCAACCCTTGTAAGCATTTCCAAGTAGTCGATGCCGCAAGCCTTCAGCGGATGGGGACCGAAATCCAAGTGGTCGT
GCGCATGGACGTACAGCGTTTGTTGGAAGCACGTGACGAGGGCACTCATTGCTTGGCAGAACGCTACCTCGAGCCGACGCTCCACATCCCATTTGAGCTC
GTTATACTTGCGCTCCAACGCGTCCATTGTGAGATCCGAGCTCGCCTGTGCTTCTTTTACAAGCCGCCCATGAAGCCTCTCTAACTCTTCACGCATCTGA
CGAACGCCGCCACTCTTGAATCCGTATACATGTGCTGCAAAAGCACCGACCGTCGTCGTGCCGTACATCCGATGCTTGTGAAAAGGAACTCGGCCTCTAG
CCCTCGTGTTAATCGACAGCGAAGGGTTTTTCGACTGCGCGCTCGAAACTGAGCCCTCTGGAGACCCATCACCATCGTTGGTTGATACGGCCCGCTTCAC
TTCTTCGGCATCAACACTGATTGGTGCTACGTCAGCAATGACATCCGTCGTCATATCCGACGAGTCAACAGTATCATCAATGCCATAGATACTCTCGAAT
TCCTCCTCAGTAATTCCCATCGCCACAATGGTTTCTGCCAGCTTTCGTTGCTCAGAAGGAACAGAAATGGCTTGGCCTGAAGCTCCCTTGTTGACAATAG
TCTCAGCAGAGTCAAATGATATCACGCGCCGACGGAGGGCCTCTACAGGCTCAAGAGGCGATTCTTCGGAGGGTGGAGAAAATACGATCTCTTTCTCGTC
GTTGATATCATCATCGATGAACTGCACGGAATCGAGGTCAGTCTGCTGTCCGCGCACGCTGGATTCTCTCGACAAGTGCAATGGTGACGACATTAGCGTC
CCGACAAATGAATTCACAAGACGGGCGTAGCGCGCCGCGCTAGTTTGGTCGCCGTATTGGACGTCTTTTTCAGACGTAGGGGCTGCATTACCCACAGTCA
TCAATTGCTGATGAAGATTCAACGCCAGGAAACGTAGATCCGCGTCTGCTTTCATAGTGCTTGGTTTGAAAGTGAGCCCCGCATGCTGCGTAGTTCCGTA
CCGTAAAATCGAGTCTTCTACCTCCGATATGTACTGCTCCATTGTTTTGACAAGATCCAGACGCCACTTTCGCTTTTTGCGCTCAATGGCGTCATCTTGA
ATCTGAATGATCATCTCCGACAGCATTCCGACGCTGGTTGCCGGCCTAACTCGGTTCTCAAATTGAAGCGAAGAGCTCATTCCGGATGCACCAGATCGCA
GCGATTCTGAGTCTTCCGACGACTGTGTCATGTTAGTCCTATCATGCTCTTGCACAGTGCCGAGGGCTCTCGGAGAGGAAGGAATCGCTGAGGGTAGTGA
ATAACCACCGACGCTTGGGGTTGACAATTGACTGGAGGGGGTCGACGATGAGCTTTCATCTCCATCCTCAGCCGCAATTTCGCGCTTTAGCGAGTCAAGT
TTGACCAGCAAGTCAGACAAGATCAACTGGAGCAATTGATAAGGTACCTCCCAAGTGTACACACTTTCGATCAGCTCTTCTTCGACCAGCATTTTTCCTT
GTGAGCGTTGGGAGGTGGATGCAAGATTGATCATCTGCTGAGCAATCTCCGAGTACGTTGAATCATCGCGGGGCGAGACATCATCTGCATCGGTATTGTT
AATTCCGATATACATGAATGATCGAGTGATGCGCTCGAGCCCGCCAACAGACATTCCGGCGTGTAAACCTTTTACCTCCGCTTCGCAGCGAATAACGATT
TCACCTGAGGATTGCGTCCGAGATAGCGGGGAATACAGCGAAAAAATGGACGCCCGTCCGATTGGGGGTGTTGAGCCCGTCATAAATGACGAAAGCGGAA
CAAGCGGGTCTCCGACAAGCCACTGGCTATTCAGGTCCTCCAATGAGTTCTCATTTCGAACCGAGTACACCGAGGCGCGGAGCAAATCCTGCTCGCGCAT
TTCAACGGCCACCATCATGTGGAAACACGGGTCCTCAGAATGCGAGATCTCGGTTCGACCAACCTCGGTCAGTACTGCGCCTGTCTCGGCATTCATAAGG
TGTAGCACAACAAACGATGATGACGTCAGCGATGATTTCGAGGGCAGCTTCAAATTGAAGCACTGAAACGATAACCACGCGCACGGCACATTTTGTGAAG
CAGACCGTGCTGGCCATCTCGTGTCATCGCTCCATGACCCATCGGACACAGCCACCTGTGTTGCCTGTCGCTCGTACTCGGACGCTGACGGCGAGCCTGC
ACTGCTCGTTGAATCAAGCCTTGCAGACCTGCCACATTGCTGTTGCTGCTCTGAGTTTCCTCCACCCAAATGCTGGCGAACCACAAGCTCCAATCGTCGT
TTCGCGCGGTCCAACACGCTACTTCCAAGCCCCAGGGACAACGGACTTGGGCGTCGACCAACCGTCAAGTACCCTCCCTGTGAGCCCGGAGGCGAGTTGG
GTGGCGCCGCTCGGGCGACGGCATCCCCACGATTCTTGGCTGCTACCAGCAGCGGCCTGGGCAGCACCTCGTTGTCCAGCAGCGGGGTGGCCTCGGACGT
GACTCGACCGTTGTTGTAGCTCAGGCTCCTGCGCGACGGGATCTCGAGCGTCGGCTCCACTTCCCACATGAGCACCATGAAGAGCACGCAGGGTGCAATC
TCGGGGATGGCGTAGCCCACAATGACGCACACGTCGGGGCTGTGGATGTCTCCACATCCCTGGTGAGAGAAAGGTCGTTGAATGTACATGATTGTCCTTA
GTAGGAAGAGCGCCGAGCACGCCCCCATGACGAGCCCCGTGAAGCGCAGCGCCCGCGTGAGCTTCCGCTCCACCCGCTCGTCCAGTCTGCGTCTCAGGCC
GTCGCCCGAGGGTCGCAGCACACGCTCCACGCGCAGGCGCATCTGCCACGTTGAGTATAGCAGCCCCAGCGAGCTCACGAGGCTGCCCGCGGCGATCAGT
AGCACGGGCAGGACGCCCGTCCAGAGCGTAGCGCGCTTAAGCCGCTGGTGCTTGCTGCGGGCTTCGGCCACCGCAGCCTCGTGCAGCAGTGAGAGCCCCA
GCACGAAGGCATAGAACAGCCCGTTTGCCAGCACGAAGGCCACCCAGATGCGTCTCGAGCGGCGCGAGACCTTCGGGTTGGCGATGTCGATCCACCAGAG
CGTCTGGAAGAGCACGAGGCTGAAGAACAGGCACAGCGCCGCGCGGTTCAGCACGTTGCGCAGTACGCCCTGGCTCACGAATGACGCGGCCCGGAACAAC
GCAAAGAGCACCATGAGCCGCTGGAACGTGCTGCGCTGGAAAGAAGTGGCCTGCGCGCGGCACGCGGCCACGAGGGCCAGAGACACGTACAGCGCCACGC
ACAGCAACTCGAGCGCCGAGGACGCGCGCGGCAGGAACACGAGGCCGTCATCCACGTCGGAGGGGGAGGCCATGGGCGC