Description :
From Genome Similarity Track
Location :
Scaffold_469:5040- 8741
Sequence
3701 bases(100 bases per row)
TTGAGCTATTCCCACGATTGGGATGTCTAACGATCAATCCAAGTCTTCTCATTGAGGACACTCTCGTCCATCTATGATCTAGTGAGAACTCTATCATCTT
CGGCAAAGACCATTGTCGATCTGATATCACTAACGAACTCATCTTCCGCGACGATTTCGCCAATCAGATTGACTTTGCCATTACGCCGATCACGCAAGAA
CCTCTTTTGCTTCATCTAGGGGTAACAGAGTGGTGTCCGAAGTTAATTTCGAAGGCGCGATCAGATCAAGTGTATAACTATCTATGCTTGGTCCATTGTT
CACCAGGACATTCAATGCCTCTGTTATCTCATGGGAACTTATTTCCACAGCCTGTTGGGGACTTAATTCCTTAACTGTAGACTCTTGGGATAACTCATCT
TCGTATGCTGATTATTCGCAATTAATTGGTTACTTCCTGGGTGTTGTCCACTAGAAGGCACCCATTCCCCGGTCTGCTCGAATTATTCGAGCGGTGAGCC
GTCAGAGCTTCATGCGTTGCTATTCAGTCGCCGTTAACTTGTTCCACAGTGCGATAATTAGTCACATTGCGATTCTTTGCAGTTGTACTTATTACCGAAC
GACACGTGAGGCCATCGCACTCACTTGTAGTACATCCACATGGTGGTGGACGCTCCGAGACGTTCATCAGATGGACGTCTGGTGAGCATGCAGCAGGCCT
TTCAACTGTTTGTCGATGCCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGTTAACCAAGGATAGCATCAAATTTGTCGTCCAAGTCCAATTTGATG
AAGTCATCGTCGTATTGGACTTCTTTCAGTGTATTGGTTATTACCACTACACGTTTTACCACTGTTACGGAAGCGCCAGTCGCGAGGAGTACCGTCATTC
TCGTTGGAGGGATCTCGCGCTCGATAAATTAAGGCTTGCTGTCATCTAGCGACTGGTGTCGCACAAAATTGTTCGACGCCCCACAATCGACTGGGCTCGT
AGTGACATGTCCTTTACCACTTCGAGTGTCAAGTTAATGAGATAAACTCATTACAAGATACAGTAACACACAATGATTGCGTGTTGGAATCAATTATTGT
CAAGAGGCTTGCAAAATCACTTGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTTACTATCCGTTACGATGTTGTATTTT
CGCAACAAGGACGAACCCATGCCTCGGACACCTCTTGGCCGCTTGGCGGATACTGCTTACTGCTGTACGTGATACCGCGTTCGGGGCACTGCATTCGTAT
GCGTAATGCCCTGAATCTTGACATTTATTGCATCTATGCAATTTCTTATAATTTGTAACGCGAGAGCTTTCACTCTTATCGTAACAGAAGTCCATCGGTT
CTGGACCTCTATTATTCTGTTGCCTCTGGGGACAATAGGAATTCGAATTCATGTGAGCTTGTTTCACGCTAAAATCTTCCTCTTCCGCAACCTCTTCCAG
GGGGAACAAATTTAGTCGGAACAGGAAGATTTTGACTGGACCGTCTGTGAGACCTTGCATGAACAACGTGATCAACATTTGTTCATTCAGCGGATTTGCT
GTAGTGCAACTCGTTAGAGACGTATGTACTGAATGCATGAGTGTATATCTTTCCCTTGTTTGAGTCTCAGGAGTTCACCGCGAGCCCTAGCGGCGGTTCG
AATGTTTGTCTGAGCCGGGATTTTAAGACCTTTAACGAACCGAAGACATATGGGTCGTGAATCTTGAGGCTCAAGGCCCAAGTATTCGAACGCCCTTCCA
AGGCTCGATTAAGCAATTGCGACCTGCATTTGCTCATAGACGAGGAGGCGATTCCTTATGGCGTCATCCATTTCAACAAACCATCTCAACAGAGAGACTT
CTTTAGCTCCTTTGTACTTGGAGATATCAGTTTTAAGCGATTCGGGTCTACGTGTGTGTGTCGTCTCGGTAGCTGTAGCCTGCTGCTGTATCAACAGTTC
AAACTGTTGAGTACTCTGTTCTTTCAACAGCTCTGTATGTTGAGACCCTTGTTCGTGAAGCAAGGCTACCTTTACCCGTTCAGCGTCGAGTTCATTCTGA
ATGGACTTGGCGATGGTGGCGTGCTGTCCGTCTGAACCCAGAGCGGGCAGCATTGCGCCTATGGCTTCTTGCCCTATCGTCGTACTCAAACGTTCGACGG
CATCCCATTCGATTTGACTCAAATGGAAGTTTATCTCGTGCGTTGGATAGAAGTCTTTCACTACATCATCCAACATGTTCATAGTCGTTGAACGGACTAC
AAAGTGCTACCAAGTGTAACGGGGCACCGGGCGCTTGTACTGTCACAGTACAAAGTGCTTACACTGAGCACAGAGTAAGTAGGTGCCTCGAAACTTCATG
TATACGTATCATGCAAAAGAAGGTATCAATACGAGATAAGGGTGATAGTGAGCTGTATCTAGGTAGTTAATCTCCTGTTAATAAATCCTATTTAATCTAC
TTTTAACTATACCTACATACAAACATGTATTGTAACTATCTGCTCACCACTCATTGCGTTCGTCTGTCGTGGCTTGGCTCTAATATATGATATCATTAAT
CTATATCAACTAATGAATAGTGTACAGTCTTCCCTCCGATAAGTTTGCCCCCGATAAGTTATAACCTCTAGTAGGTTATCGATTTCCGCGTCCACGGACC
TCGTTCTATGGCCGCTAAGTTATAAGTTTTAAGTAATGATCAAGTAGGGCAATATAACTTTAAAAATGAGCACTTGTTTTCGTATTTTAGAAGAGAAAAA
CTACTTGAACCACATGTAGAGGGTGTTTTGGGTGGTGGGAGTGTTGCGAAGATCAAGCTGGAGGTTGCGAAGGACTTTTATAAGCAGCTGGGTGACTTTC
GGGGGATACGTCGAGCAGGGAGCAGGCATCACGAAGGAGGTTAATCTTCTCGGTTCTGGTAAATTTTTCTGCGACAGGTGCCGCATCTTCAATGTTTTCC
TCATCATCATCTCCTCTCAAAACCTCTTTTAGAATCTCGTTGTCGGTTAGCTCAGGCTGAGCAGTCTCATCCTCTTCGACGGAATCGAGAAGCTCCGAAA
TCTTCATGGGATATCGGACACGCAGCTTCTTGAGCTGTGCTATCAGCTCTTGCTCCAGCTCAATTTCTTCCTCCTCGACCTCCGTTGCGCCATCTTTACT
CCTTTCTACCTCCACTGCACTTGAAATGACCGATTCAGTAGAAAAAAGCCCCGTTTGGCTGAAGCAGTTGGCAATGGTAGTGCTTGAAATCTCGTTCCAT
GCAGCCACCGACCAGCGCATGGCAGTAAGTTGGTCGACTTTGTAGATGTTAAAACCCTCCCTACGCTCGTCACAGTCGATCGCATTCTGCAGATGGTAAC
GGCGATACCGCCGCTTGAACGCTGCGTTGACACCAGCATCCATCGGCTGAATCATGGAAGTCGTACGTGGTGGAAGCAGCTGGACCTTGACGTTAGTTAA
CGTAAGGTCATTCATCATATGCGACAGAGCATTGTCAATCAATAGAAGGATATTACTACTCCTGATCTGAAATAATACAATATTAGAATAATAAGTTTTC
TAATTTCAAATGGCTATGCACCTTCATTGTTTTGTCTAGATTTACAAGCCATTCCTGGAAGAACACGTCCGTCATCCAATCCTCTGTGTTGTTGCGATAG
A