Description :
From Genome Similarity Track
Location :
Scaffold_1611:504- 2356
Sequence
1852 bases(100 bases per row)
GAACCAACAAACGTTGATTACGTTGTTCATGAAGGGTCTGACTGATGGTCCTGTTAAAACCTACCTGTTCCGATTGGAGTTCAACACCCTAGAAGAGGCA
ATAAGGGTTGCGGAACAAGAGGATTTCAGCGTGAAATCAGGCTTACGCGAATTCTAATTCCTATCGTCCATCGTAACGACAGGAAATGGAGGCCCAGAAC
CAACGGACCTCTGTAACGCGAGGAGCGAGAGCTCTCGTGTTAGCAACTATAAGAAATTGCAGAAATGCAATAGATGTCAGAATACAGGGCATTACGCATA
TGAATGCAGTGCCCCGAGCGCGGTACCACGTACCGCAGGGAACAGTAACCGCCAAGAGGCCAAGAGAGGTCCAAGGCGTGGGTCCGACGTTGTTGTGAAA
ATGCAACAACGTAGCGGACAGCCAAAAAACGTTCAGGGTCAGTAGATGCGAAGCACCCTACTGATCCAGCAACTTCAAGTTAATTTGTAGACCTCTTGAC
AAGAAATGCTCCCAACACGCAATCATGTGTGTTACTGCATCTGGTAATGAGGTTTTTCTCATTACCTTGAAACTCGAAGTGACACAAGGCATGTCACTTC
GAGCTCTAGTCGATTGTGGGGCGTCGAACAACTTTGTACGACGATAATCGCTAGACAATAGAGAGCTCAAATATATCGAGCGCGAGATCTCTCCAACGAG
GATGACGGTACGCCTCGCGACAGGCGCATCCGTAACAGTGATGAAACGTGTAGTGGGTATTACCTATAAACTGAAGGGAGTCCAATATAATGATGACTTT
ATCATATTAGACTTGGATGACAAATTTGATTTCATCCTTGGACTGCCGTGGCTCAGAAGGTACGAGCCACAAGTCACCTGGCATCGACGAACAGTCGATA
TGCTCGTCACTTGTTCATCAGATGGCCATCTGATGAACGCCATGGAGCTCCCACTAACATGTGGGTGTACTACGAGCGAGTGCGATGGCCTCGCGTGTGG
TTCGGTCATTAGTACGACTGCACATGGCCATGGAGTGGCTGATCGCCACACCATGAAGTCAGATTCCGGCGACTGCATTGAGATGCAGGTCGCGCCGAAA
GCTCGCCACCCGAATAAGTCGAGTGGACTGGGGAATGGGTGACTTCCAAATGAACAACACCCAAGTGAAATTGAACCGATTGCCAATGATTGGCAATACA
ATGATCTTAGTGCGATTAGAGAATCGCACGTAGAATGCCTGGTCGCGGTAGCGCAACCACCGCTAGAAGATAACGAGGGAGCAATTCCACTCGTGTCAGA
TGATGAGATAGCCATAGAGGCTAGAGTTGAGGGAACAAGTCCCCACCCAACTGTGGAAATAAGTTCCCAGGAGACAACAGAGACATTAAATGTCCTAGTC
AATGACGGATCAAGTATAGGCACTTACCAACTTGATCTGATCGCGCCTCCGAAGTCAACTTCGGAGATCATTCAATTGCCCACGCTCGAACAGAAAAGGT
TCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATCTGTGTGCTCGTCGCGGAGGATGAGTACGCCAGTGATATCCGATCGGCAATGGTCTTTTCCGT
AGATGAACGAGTTCTCAGTATCTCATCAATGAACGAGAGTGTCCTTGATGAGAAGACTCGGATTGAGCGATACACATCCCAATCGTGGGAATCGCTCAGA
ACAAATCCTCTCTACGATGATTTGATGGAATTCAGGGATGTGTTCCCAGAAACAGTCCCGTGCGAGCTACCTAAGGATAAAGGTACTCGTCACGAGATAG
ACTGAAACACGTCAAAGTACTGTGTCATGAAGCAATGGCCATTGCCTCGTGA