Description :
From Genome Similarity Track
Location :
Scaffold_336:504- 2320
Transcript NameFunction/comments
g17511.t1hypothetical protein

Sequence
1816 bases(100 bases per row)
GATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGATAAGGGTGTTTAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGGC
AGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGTGGGAATCGAAGTCCCCGCACAGCGC
GCCTACGTTCTGTGTCAAGAAGCCACAGGGAGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACGACGCGACGGTACCGGCGCAGACGCCGATACCT
CGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATA
TCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCACAGGGTCCAAAGAACGCCCCAGCGACGTTCAACGGGTGCGT
CACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGATGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAGATCGGATGTGGAGATG
CATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTGTATGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTAC
TTGGGTGTCTCGTGGGGATGAACGGCGTACGCCCTGACCTAGGAAAGGTCAGAGTGGTCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCA
GTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGAAACTACGCGGGCAAGATTCGCCCGCTGTTGCACCTCTTGAAGAAAGATGCTGCATGGGAA
TGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAATATCG
CCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCG
TGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAACGTTCCGAGTGTATCTACTTGGGA
TTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGACTAAGTCGCCGCACATATCCCAAAGAATGGCACGGTGGCTGTCATTCTTTGC
GGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGAGGTGCACGAAGCCGACGCC
AACTGCGTTGGTGTCGTCAGGACGACCACACCCTCGTCGTCCTTACTGGATGACGTGAAGGTCGCATACGCACATGATGCGGATGCGAAGCAGTTGTTGG
AGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGTCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCATTA
CAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGACGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGA
CATCCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGACTTCTACTGGAGCCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTAT
GCCAGCGCGTGAAGCC