Description :
From Genome Similarity Track
Location :
Scaffold_4126:504- 1746
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4126-fgenesh-gene-0.0Equilibrative Nucleoside Transporter (ENT) Family

Sequence
1242 bases(100 bases per row)
CTTCATCTACTACGGGCTCATGTTCCTTAATGGCTCCGTGCTCTGGGCGTACTACTCGTGCCTGACGGCGCAGAACTTCTACGCGACCAAGTTCGCTGAC
ACCAAGTACAACTTTTCCTTCTTGACGACGCTCTGTACGGCGTGGCCCATGGTTGGCGGCCACTTCATCCAGATCGTCACGGGCTTTGACAAGAAGGTGG
GCCAGAAGCCGCGTGTGTACGCCGGCTACGCGATCTTTATCGTCTGCTCGATTCTGATCATGGTCTTCAGCGCGATCAAGTTCACGAACCCCGACACGGG
CGCGCTGCTCGTTCTCATCATGTTTGGCTGCATCGGCTTCGGTAACTCGCTTTCGGAAGCCACGTACTACTTGCTGGCGGCGCTTTTCCCCGTGGAGAAG
TTCACCAACGCTGTCCAGATCGGCAACGTGTGTGCTGGCGTTCTTAACGTCACGATCGCTACGGTGCTGCGCTTGATTGTCGGTGGCCCCAAGGCCACCA
AGTCGTCGGATGAGCTGGCATTCTACCTCTTCTTTGGACTCCTTATCGTCGTGCTCATCGCCGCCGTGTTTCTGTACAAGAAGTTGACCTCTCTCGCATG
CATCGTGTTCCTCTTGGAACGTAACGAGGCCTCGACGCGCGAGCACAACTTGGCGCTCAACCCTATTGAGAACGTGCGCCACCTTGTGCGTGTGTTCACG
ATCATCTGGGTGCCGGCCGTCACGCAGTGGCTCATCTTCTTCGTCTCGCTCTCGGTGTTCCCCGGCTTCGGCTGTGCTGCTGGCCGCAACCTCACCCCGA
AGTACACGAGCACGGTCTACGGCCCGGTCACGGGTCTGTGGTACTGCTCACCGGGCATCATTGGCTCGTACAACTACGGTGATTTCATCGGTCGTATCAT
CTGTACGGCGGCCGTGTACAAGCTCTTCTCGATGAAGCTCGCTTTCGGTCTCGCGATCCTGCGTATCGCGTACATTCCGATCATGCTCATGGGCGTGGCC
GGCACATCGGTGTACATTTTCGGCGCGCACGTTGAGGCTGCGTTGGTGTGGAACATTTTGTTCAACCTGACAATTGGTATCACGACGGGTCTCCTGTCGA
CGATCACCATGGGTGTCGCTCCGCGTCTGTGCAAGCCCGAGGACCGTGAGACCGCCGGTGCGGTCATGGTCTTCTTCCTCTTCCTCGGCATTGCGTCGGG
TGCCCACTTCGGCTCGGATGTCAGCACCCACGGCTGGTTGGG