Description :
From Genome Similarity Track
Location :
Scaffold_24:50384- 51411
Transcript NameFunction/comments
Physo_133048PREDICTED: similar to SD06318p

Sequence
1027 bases(100 bases per row)
GCTGAACGACTACATGGAGGAGATCTCGGACCCGCGCAACCGCGCCGAGACGGAGCAGTACCTGGCGCAGCTCGAGAACGAGCAGAAGGTGCCGGCGGAC
AAGCAGCTCGTCAAGCCCAAGCCCGGATTCGTGGTCAAGACCAAGTGGGACGCCGCGCAAAAGTTGTTCGTCAATGTCTGCAGCAGCGACAAGATGCAGC
CGCCCTCCAGCACCAGGGTCACCTCTGGCCAGCAGGGCACGTCGTGGAACCTGCCCTACTCGCTGGGGCTGGAGAGGCTCGAGCCCGACAAAGGGGGCTC
CGGCGTCCCGACCTTTGACGTGTGCTTCCACCCGCGAGTCATTGAGTTTGCAATGGCTCGAGCGGATTACAGGCACATGGTGATCAGTACGTGTCTGGAT
GCGGTCGAGCCGATATTGAGGGACTCGAGGCGCAAACAGAAGGCGGTGCTGGCCAGGAACTACCACATCCTCAAGGGCGTGTTCTACAAGTCCGGCGACC
CCGTCACAATGTGCTTGCGGAAGGAGCGTGACGTACTGGGGCCAACCAAGGCAAAAACGACAAAGAAGGTGGAGACTAAGACTACCAAGACCAGGTCTAA
GGACAAGATCACGGCGCTGGGGGATAAGGAGAATGCCCCACCAGCTCAAACGATCACTCAGGTAGGTGGTAAAGCTGATGATTCAGTGCTAAATCAATTG
ACGCACGTGAAGGACAAGGAGAAGAACACCGCGCTGATGAAGGAGGTATCGAGCGTGAAGCTGGAACCAAAGCAGAAGCTTGACAGCCATAAGCAAAAGA
AGAAGATGGAGCACCAGCTCATTTACCGCGGGAACTTCGAGCTCCTCCACCACATGCAAGCGGATCCAGGGAACAAGGTCCCTGAGGATCGCTACCGCCC
GAAAGAACTCGTCGTTGAGGTGAGCTTCCCGCTGTCGACTAGTGCGAAGGGATTAGATCTGGACGTGAGCGAGCGGATGCTGCGGCTGTCGGCCGGCCCA
AGTGTTCCAGGCAATTATGAACCTCTG