Description :
From Genome Similarity Track
Location :
Scaffold_492:5038- 8149
Sequence
3111 bases(100 bases per row)
CCCGTACTGGTGATAAGATCTAAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTACATGGCAGTTCAATCGTGTATGCGTTGCCTAGCGGCGCA
GTACACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCATGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTAGATAGTAGGACTAGGTT
ACCTTCATTGAATGAAAGAACATTTGCCGTTCCATTCTTGTCTACGTTTTTCTTTTGTCGGTCCACTGCTTCAGCAATGGAATCTTGCACGAAACGGACA
ACCGTTTCGCGAGCCAGTATAAATTCATTCGCTGACTCGCTGTCTTTAGCTGTAGTGCGCTTGGAGCTCACTGTGGCAAGATCAGTGACCTGGGTAGTAA
GAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGTGTCATACGTAGTGACTTCGTGGTCAGTACGTGATGAGTGAGA
GCCGAGTTGGCATTCGCTCGAATGATTCCCTCTGCCCTCAAACTAGACTTATACTCTAAGAACGTGAATAGGCGTGGGTGGCGCAAGCCATTCACGAAGA
ACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCAAATTCCACCATTGGCGAGAATTCGCTCCAATTCTTAAACAAATGGACATAACCCCT
AAGGATTTCCTCAAGAATGCGGTTTGCACGTTCTGTCTGACCGTCTGTTTCAGGATGGTCAGAGGTCGACATCTGAAGGCACGTTCCGGGTGTTTTGAAC
ACGGATCGCTAGAATTCTGCAGTAAATCGTGGGTCTCGATCACGTTCAAGAATACCTGTATTCTTATGTGGGTCTGCGGGGAATCCAACGACAAAGTCCA
TTGAGACTGATTCCCAGCATTCTGCCGGAATAGGCAAGGGTTGCAACGGCGCACGAAGTGAAGGACCAGACTTCACTCGTTGACATACTTCGCATGCGCG
GACGTACTTTCGCACGAGTTGATACTGGCGGGGCCAGTAAAAGTCACGACTAACTGTGAGATATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCA
TCGTGGTACTCATACATGATGTGCAGTCGCAGGTCACCATGGTCCGGTACGACGACACGAGGCGTGTCGCCGGCAACGGCTGTAGACTTCAGTAAGCCAT
TGTGGACTGTATATCTATCCGTGGAGGATTGATATACTGGGGGCAACCTTTTAAGGGATTGACGGGATGTTTGCGAGACATGTTTCATCAAACGCACCAT
CGCCGGATAGTACGCCATGCGTATGTCTTCTAGTAAGGTTGACGACGGGACACTCGATGTCAACACCGCGACAGTGGTCGGACCAGTGTCGGGTTGCGCA
GCCGGTTCAAAATCGGGCCGGCGCGTCAGAGCATCAGCGACGACATTCAGCCGTCCTGGTTTATATTCCACGGAGAAGTTATACTCCGCGAAGAACGACA
GCCACCCCGCCATTCGTTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACGCATGGTCCGTGTATACGATGAAGGGTCTACCAACTAGTAGGTA
GACCCTGAATTTTGCCAAAGCATACTTCATGGCAAGGCGTTCCTTGTCATAGACTGGGTAGTTACGTTCAGCCGGTTGCATCTGACGTGACTGATAGCAG
ACGACACGCTCAACACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAATCACTTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTG
CAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTCGAAAGAGCGCTGGAAATCAGCACTCCATGCTCACTTCTCGTTCTTTTTCAATAA
ACGAGAGAGATGAACAGTCATCTTGGCGTAATTGTGCGAATATTTGTGCAAATACGCCACTAGGCCAAGGAACTTTTGAAGTCCTTTTATTTGAGTTGAT
TTATTTTTTGAAAAGATTGAAAAGTTATTCTTAAAAAATACATATTTAGGCACCGGCCAGTCAGTGATCACCTTGATCTTTTCCGAATGGGGCCGGACGC
CGTGCTTGCCCACGATGCATCCAAGAAGTGGTATTTCGCTTGCAGCAAATATACACTTCTTGAGGTTGGCGTACAACTTGTGCTCACGCATCAGTAAAAG
AATCTTTTGTACGTGAAGTCGGTGTACTTCCAAATCCATCTGTCCATCCATAGCCCGGCTATGGACGAACACGTCATCAAAACAGCTGGGTGCGAATTCT
CGCACAGATTTCAACAGATTCGTAACACATCTGTTGAACGTAGCAGGGGCATTACTCAGACCTTGTGGCATTACTAGCCACTCCCAAAGCATACTGCTTG
GGGTTCTCACTGCTGTATAATGAATTTCCTTTTCACGCATAAGGATCTGATAGAACCCGTCATCAGATCCATCGATGAAAAGATGGTACTCCTTGACATA
CCATCTATAATGACATCCTTTCTTGGTATCGGCGTTTGAGCCGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTACTGTCCGCCATCCTCCTGTGG
CCTTTCGGACACAGAAGTTTGGAGAGAGATGTGAAGAAGTAGATTCCCTCACATGGCCCGCTGCCAATCGATCAGCAAAGAATTTGTCAATAGCTAGTAC
TTGTTCACGAGGCAATGGCCATTGCTTCATGACACAGTACTTTGAACCTGGTTTCAGGTCGATCTCGTGACAAGTACCCTTATCCTTGGGTAGCTCGCAC
GGCACTGTTTCTGGGAACACATCCCTGAATTCCATCGAATAATCGTAGAGAGGATTTATCTTGAGCGATTCCCACGATTGGGATGTATATCGCTCAATCC
GAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGAGAACCCTTTCGTTCTTAGCGAATATTTCCAAACGAATATCGGTTACGTACTCATC
TTCCGCGACGATTACGCAAATCTGATTGACTTTGCCACTACGCAGATCACGCAAGAACCTTTTCTGTTCGAGCGTGGGCAATTGAATTATCTCCGAAGTT
GTCTTCGGAGG