Description :
From Genome Similarity Track
Location :
contig_45:503772- 505352
Transcript NameFunction/comments
g9556.t1hypothetical protein

Sequence
1580 bases(100 bases per row)
ATGTAAATCATGCCACAGCGAGACACTGTCGCAGGTGACGCAACCAACAAGTCCATGGGTTCAAACATCATGCTCATGACCGAACTCATGGCAATAATTT
CCCCGCTCATCAAACACAATTTGCGGTTATCATCAAGCACAGTATTCATGTTTTCAATCCATACAGCATCCACCGGTCCATCAAACATTAGCCACTTGCG
ATCTGGTGAGGGATTATTAGCCAGATTTCTGTAGTTAATGGCAAGCACTCCATCATTCCATTCGTGAGAAACGGCATCGAATTGTCCATAGAGCTGCCCC
ATCGTTACCGACTTGGGGTTGATCACTGACACGATAACATTGGTATACCGTTGATCGTTAGGAAACTGCTGATGCAGATGAGCTAGCACTTCAGACAGCA
CTCTCCACGAGCACGTTTTCCCTGAGAATGGCATTCCCACCACCATGAACCCGTGTCGCACAATCATCATTTCGTAGATTTGAATCACCTTCTCGACAAA
GTTGGGAACTGGTTGTAGATTCATTTGTTTGCATACATGGTCGATCGAGCTCAGCATGTCTCTCCGATCTGGTGGATCGATCGTCACGCCAGGGAAAAGA
TCCGATACAATACCATTAAATAGAGGTACATCGGGGGACAAGAACTTCGGCAAATTGACGTCAATGATCGATCGCAACACTAGAGTATCTTCTCGCAGAT
GTCCTTCGGCTCGTTTCAGGTTACCAGCAGCTCTAAGCACAGCCATGACAGCTCGCATCCCGTAGTCGTAGTGAGATTGAGATGACAGCTGTTCGGAGCA
CAATGTGTAGGTCGTCGTAATCTTCTTGGAGAGAGCGCTTGCATCCATGTATCCGTAGGAGTACAACATTATCTCTGCAATCATAGCATAGTCCGGAACC
ATCATCGCTACAGTGCGGAACAACACCTTCAAGTTGTCGGGTAGCTCTGCTCGGCCAGCATATCCGGGGTTCATCGTGATGAATGGACAGCAAGTAGGGT
TTAGTCGGAGTTCTGTGCCCTCAAAAATGAAATTTGCAAGGTTTTGAGCTTTCGCCAGCTGAATACAAAGAATTTGTTGGGCAATCACCGACAACACCTC
CAGCTGAATACGATTAAATTCGTCGAAGCACGCCCAAGCACCCGAGCTCGCAAGACCCTTGAAGAATTTTCCCATTGCGAGATAATCGAGACCATCAGAA
CAGTTTGTGACGACACATTGAATGGCAATAGCCTTTGCAAGATCTTTCGTCGTCTCTGTCTTGCCTGTTCCAGCAGGACCCTCCGGTGCACCACCAAGGT
TGAGGTGAATCGCCCCCGTCAATGTCCGGTAGCACCTATCCGTCAACGGGGTGATCACCAAACGCATACTGTTTCCAAGATACTCGAATGCATACAGGGC
CAGTGTGTTAATCATTCGACACTCAAGAGTATGAGGCTTACCTGTTGTCGCCGAGACCCCACCCTGGATCCAATAGTATCGCAGTTGAGCAAGCCAGTCG
AAATCCGTTTTATCCGTGATTTTCAGATCGACCAGCTCGGCAATCGTATCGCGGTTGTGTACATCCATCACCACAAGCGC