Description :
From Genome Similarity Track
Location :
Scaffold_84:50377- 54412
Transcript NameFunction/comments
Physo_140283reverse transcriptase

Sequence
4035 bases(100 bases per row)
CGTGAAGGAAGTGAGTTGCTCTCTCAATTGCGTGACCAGTTGGTTATGCTTCCTGAGATGCGTGACTTGACCCCTGAGTGCAAGATCGAAGAGGCAGATG
TTGGAGTCTCTGGGAAAACGACGCCCGAGATGGAAGACCAAGTGAGGCGAATTCGGGAATATCATCGGAAGATCTTCTTGGGAGACGGCAATGCAGCTCC
CCCACCTGCCCGTGGAGTGGTTTGTGACCTGGATGTAGGCGACGCTAAACCTGTTGCCCAGCGTCCAAGGTCCATTGCACCACACCTGTGGACTAAGGTG
TATGAACTTCTGAAGAAGCTTCTGGAGAACGGGCTGATCGAGACTTCTACGTCCCCCTGGGCATCTCCAATCGTGATCGTCCTCAAGAAGAATGGCGTCG
ACATCCGGACGTGCATCGACTATCGCGTGGTGAATGGCTTCATCAAGCTATCACACTATCCGCTGCCGCTTATTGATGATCTTTTGATTGGCTTTGAGTC
GGCGATGTGGTTTATGAGCTTGGACATGGCGAGTGGTTTCTGGGCTATCAAGATGGCCGAGAGAGCCAAGTTGATCTCTGCGTTCGTCTGCTCCTATGGA
CACTACCAGTGGCGTTTGGCCTCAAGAACGCGCCGCTGATCTACCAGGCAGTTCTCAATAACTGTCTGTGGGGATTTCTGCGGCTTTCCCCTGAGGAAGA
AGCTGAGGTCGACCAAGATGTCTTGGACTTTTTGGGGTTGAACTCTGGGGAACCCAGAGCTTCATGTGAAAATGCACCGCGACTTTCAGTGTTGACGGAT
GAGATGACTGTTTTTCAGCGTAACATCTCGGCTCCCTCTCAGATGGGCCCTGTCCTGGGTCGAAGCTCGTATATCGACGACATCGCCCACGGTGCGCCTA
CTTGGGAGCAGCTGTGCCAGGATCTGAACGCGCTGCTCTTCCGACTACGTTACTGGAATCTCTCTGTGAGTCTTCCCAAGAGCGAATTCGGGAAGTTGTC
CATTCCGTACCTCTCTCACGAGATTAGTGCTGAGGGCATCCGAGCGACCCCTAAAATCGTGAAGGGGGTCCAAGACTTGCCGTTCCCGACGGCACTGAAA
GGCGTCCAGAGTTTCATGGGGAGTCTGAATTACTACAACAAGTTCATTGAAGATCTACCCGTGATCGCGGCCGTCCTGTACGAGCTGACTGAGGAACAAG
TGAAATCCAGGAGAGACCTGTCGAGAGCCCAGGAAGCCTTTGAAATCCTGAAGCACAAGATTGTTTCGACTCCGTTACTCAGACATCCTGATCGCTCAAG
GCCCCTCGTGATTATTCCCCACGCGAACCCGTGGGCAGCATCCGCTGTGTTGGGTCAGGAGTACGACGGGATTGTGCACCCGGTTCGATTCACAGGTCGC
GTCCTGAATGACGCTGAGCTGCGGTATCACATTGCGGAAAAGGAGGTGATTGCTATCCTAAGGGTCCTGGAGGTGTTTCGCACTTTGGTTGAAGGCAGCC
CTAAGATCGTCGTCTACACGCGATATTCTGTGTTGAAGTGGTTGCTGACCTCGCAGTCGGCAGACGGTCGAACGGTGAAGTGGGGTCTGAAGTTGTCCCA
CTGGAACCTGGAGATACGCAGAGTTCAACGGGATGAAGACGGCTTGGCTGCAATTCTAGGTGCGGGTATTACCCCCAGAGAACACTTGGATGAGATCGCT
GAAAACCTGATCCCAGCCAAGGGGCGCGTTAAACCTCCAGTGCCTATCAGTATGGAAATGCTGGAAGCGGACTATGAGGGGTGTATTCTGAGTTTCGATG
GCGCCGCTAAGACTTCCACGCGACAAGGGAGCTGTGGCTTCATTCTGTGGCATGTCCCTGGGTGGGAAATCCTGGATGCCCAGGGATTAATCCTGGAGGA
CGTGACTGTGAATGACGCTGAGTATCATGGACTTCTGAAGGGCCTCACTCTGGCGATTGAGCGTGGAATTCAGGACATCGTTGTGGTTGGGGACTCCAGG
ATTGCCATCCAGCAAGCCCAGAGTCTCATCAACTGCAATCAGCCAAATCTCCAGAGGAAGCTGGCTGAGTATGAAGTGCTGAAGACGAAGTTCAAGTCTG
TGCGGCTGGTGCATGGTTTAACCTACCTGACGTCTAAGACCCTCGCGCTTGGTGAATCCTGGAAGGTGGAGGATGTTGACGAACAAACACATCTGCAGTT
GGTGTCCAAGATTCACAAGAAGTTGGTAAGACCGAAGGTGTTATTGAACGTTGGAATTCAAGGGAGTGATTCTCAGGGTGTCGAAACTCTGGGTATCCCT
GGACCTGAGCGCGCTCCGTTGCCTGTGGCGGCCAAAGTGTTTGCAGTAATGACTCAGGCGCGAACTCAGGAGATCGAAGCCCAAAGCGAACCCATGGGAC
CTCTGGAGTACCAGGCGGAACGCTGGCGACGCATCAAAGTGCACCAGGACAAAGATGATCACCTGCTGCAACTCAAGGATTTCCTGAAAGGAGACACGAC
GAGGCTGTCGCACGCTCAAGTCAGGAAACTCGCGAAGGTCGCTGATGATTTCGTGTTGGATTCCAGAGAAGTCCTGTACCGCTTGAGTCGGTCTATCAGA
GATTGACCCCGAGAAATGGTTGACGAACTCAGACTCGTGGTGCCGAAAGCTCTGCGACCGGATATCTTGCATTACGCTCACGAAGATTTTCAGGGTGGGC
ACCAGGGGATCACGAGGACGTACGAGAAGCTGCGCTCTGAGTTCTACTGGCACGGCATGTACGCTGATGTGGAAGTTTTCGTCAAAGAGTGTGTGGATTG
CGCCAGCGGCAAGGGGCGCCCTCAGAATCCAGGGCCTTCCCCTGGGAACATCGAACCGAGGCGCCCTTTTGAAGTTGTGTCTATGGATTTCGCGACACAC
TTGCCGTCGGACCGTGGGAACACGTTCCTGCTGCTTTTTCAGGATGCGTTCTCAGGATTCGTCATGTGTAAACCCATGAGATACCACGGCGCAAGATGTC
GCTGAAGTGTACGAGGAGCATGTCTTCAGGAGATTCGGCGCGAGCTCGATGCTGAGGCACGACCAAGACCCAAGGTTCATGAGTGAGGTGTTCACGCGCT
TCCGTGAACTTTTGGGTAGCAAGCAGCAAGCCACTCTGGCGTATCGCCCCCAGGCGAACGGACAACAGGAGCGGTCGGTGCAGACTGTCGTGCACAGCAT
TCGAGCGTACATTGCTGAGGCGGACCAGAGTGACTGGGACGACCATGCTGAGCGCATGATGTTTGCCCTGAATACATCGTTCGATGCCGCTCGCTTGGAC
ACTCCGTTTTTTCTGGTGCACGGCTGGGACGCACACGGCACGGTGTCTGCAATGTTAGGGCCCAGGCCCTCGAGTATCCAGGAGCGCACTGCGTACGAGT
GGCGCAGGAAGCTACAGCGTGACTATAGTTATGTACAAGCTTGCGCTGAGGATCTTCAGAAGAAGAAGGCCAAGCGTGCGCGCTCTGTCGAACAAACCAG
GAAGGGGAGAGAGCTGTCCGAACGACTGAAGGCAGGATTCGCAGCCGGTGATGCTGTGTGGCTGTATATACCCAAAGTGCAGCCCGGGCTGAGCCGCAAA
CTGGCTCATATGTGGCATGGCCCCTTCAGAATTCAGGAAATCCATGACAACTTCCGCGTGAAACTCAGGGTCGAGAACACAGGATATCGCGTGAATCCCT
GAGTACACGTGAGCCGTTTGAAACCCAGAGCACTATTCCCGAAGCGGCCCACTGTGGAGATCGACGTGGACGAGGATGATGACTTTGATGCGGCGCTGTT
GCCTGAAGACAGTTGGGAGCCCGACGCTGCGAACGATGAGTACGAAGTTGAGCGAATCCTGGATTTGCGATGGACTAAACGGACTCGGACAGCGAGACGA
ATTCGTGAGTACCTTGTGAAGTGGAAGGGGTATGATGAGACCGAGTGGCTGCCTGTGTCGAAGCTCAACTGTGGTGCCCTGCTCTACGAATTCAATCAAG
GCGCAAGAGCGCGGGCCCGTTTCCAGGCCATGCAG