Description :
From Genome Similarity Track
Location :
contig_45:503766- 505346
Transcript NameFunction/comments
g10020.t1hypothetical protein

Sequence
1580 bases(100 bases per row)
ATGTAAATCATGCCACAGCGAGACACTGTCGCAGGTGACGCAACCAACAAGTCCATGGGTTCAAACATCATGCTCATGACCGAACTCATGGCAATAATTT
CCCCGCTCATCAAACACAATTTGCGGTTATCATCAAGCACAGTATTCATGTTTTCAATCCATACAGCATCCACCGGTCCATCAAACATTAGCCACTTGCG
ATCTGGTGAGGGATTATTAGCCAGATTTCTGTAGTTAATGGCAAGCACTCCATCATTCCATTCGTGAGAAACGGCATCGAATTGTCCATAGAGCTGCCCC
ATCGTTACCGACTTGGGGTTGATCACTGACACGATAACATTGGTATACCGTTGATCGTTAGGAAACTGCTGATGCAGATGAGCTAACACTTCAGACAGCA
CTCTCCACGAGCACGTTTTCCCTGAGAATGGCATTCCCACCACCATGAACCCGTGTCGCACAATCATCATTTCGTAGATTTGAATCACCTTCTCGACAAA
GTTGGGAACTGGTTGTAGATTCATTTGTTTGCATATATGGTCGATCGAGCTCAGCATGTCTCTCCGATCTGGTGGATCGATCGTCACGCCAGGGAAAAGA
TCCGATACAATACCATTAAATAGAGGTACATCGGGGGACAAGAACTTCGGCAAATTGACGTCAATGATCGATCGCAACACTAGAGTATCTTCTCGCAGAT
GTCCTTCGGCTCGTTTCAGGTTACCAGCAGCTCTAAGCACAGCCATGACAGCTCGCATCCCGTAGTCGTAGTGAGATTGAGATGACAGCTGTTCGGAGCA
CAATGTGTAGGTCGTCGTAATCTTCTTGGAGAGAGCGCTTGCATCCATGTATCCGTAGGAGTACAACATTATCTCTGCAATCATAGCATAGTCCGGAACC
ATCATCGCTACAGTGCGGAACAACACCTTCAAGTTGTCGGGTAGCTCTGCTCGGCCAGCATATCCGGGGTTCATCGTGATGAATGGACAGCAAGTAGGGT
TTAGTCGGAGTTCTGTGCCCTCAAAAATGAAATTTGCAAGGTTTTGAGCTTTCGCCAGCTGAATACAAAGAATTTGTTGGGCAATCACCGACAACACCTC
CAGCTGAATACGATTAAATTCGTCGAAGCACGCCCAAGCACCCGAGCTCGCAAGACCCTTGAAGAATTTTCCCATTGCGAGATAATCAAGACCATCAGAA
CAGTTTGTGACGACGCATTGAATGGCAATAGCCTTTGCAAGATCTTTCGTCGTCTCTGTCTTGCCTGTTCCAGCAGGACCCTCCGGTGCACCACCAAGGT
TGAGGTGAATCGCCCCCGTCAATGTCCGGTAGCACCTATCCGTCAATGGGGTGATCACCAAACGCATACTGTTTCCAAGATACTCGAATGCATACAGGGC
CAGTGTGTTAATCATTCGACACTCAAGAGTATGAGGCTTACCTGTTGTCGCCGAGACCCCACCCTGGATCCAATAGTATCGCAGTTGAGCAAGCCAGTCG
AAATCCGTTTTATCCGTGATTTTCAGATCGACCAGCTCGGCAATCGTATCGCGGTTGTGTACATCCATCACCACAAGCGC