Description :
From Genome Similarity Track
Location :
Scaffold_136:50375- 52381
Sequence
2006 bases(100 bases per row)
AATGCTCCACAGTTCAGATCTGCCTCGTCTATTCAACTGGGTTCGTCATATCCACGCCAATGCACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTCC
GCTTCCCCGACCGCATATCGGTGATCTTCTCGACTTCGAACTCGTCGGTTTCGAGATCCACATTCCAACTATCTTCCGGTAAGAGGACTTCGTCGAAGTC
GACGCGGTCGGATACATCCACTGAAAGACGGATCTGTGCCGACCCGGATATTCTTTGACCAACTTCAACTTGGATACGTGTACCACAGGGAACAGGCGAT
ATTCAGTACCTGCCGTTTCCAACTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGGTGGGCTAATTTGCGGGCGTACCC
TTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCA
CTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTCCTCTTCTTGGTGCTGC
ATACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTTATCGC
GAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGCC
GACCCGTTAGATTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCC
GATCATGTCTAATCATTTCGCTAGCTCCAAATCTTCGGAGAACACACTCCTCGTACGATTCAGCAAGTGTTTGCGCAGTTCTAGATGCACTAGCCTTGGC
TATCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTCCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGG
AAAGGGTAAGTCGCTTGGACATTCCCAGGTGACTCCCCTTCGATTGTGGGTCTGCCCTTGCCTGTCTCACAATCCACATATTCACCGACATATCGTTGTA
CGCTCTTGAATAGTCCTCTCCAGTGAAAACATTCCGGATCCGTTGGTAGGTCCGACCGATGCCCTGATGTCCACCTTCTAAACTAGCGTGGTAGTGGTGT
AGGACATCCTGTTGTAAGGTCTCTGGCATCACCAATCTCATCAATCCATCTCGATCCTCGTGGACTCTCTTCGTAGGGGGGGGCAATAGAAAAGCAAGTC
ATTCAGATCCACTGCGTAATTCGTAGCGATAATGCTGTAGGATTTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGATACTTCTTTAATCCC
AGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCTCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATACAATCCTTC
CTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCGACTACCACCACTTCGTCTAGTCGATTCAACGTAACGAGATCCTGATGCTC
GGCCTCTCTCTCTCTCCACTTCAACGCCGCATTGAATCCGTAAAGCGGCACTGGCCAAGCTATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAA
CTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATT
ACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTTTAGCAAATCCAGACCCAGAAGGAGTCCGTTATACTCCGCTTCATTGACGG
TGAGAT