Description :
From Genome Similarity Track
Location :
Scaffold_604:5036- 9788
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_604-snap-gene-0.11Sodium/hydrogen exchanger

Sequence
4752 bases(100 bases per row)
AACACGGCAAACACTCGACGCAAGCAGCACCAGTGCGTGAGGTTAGTGTACACGCGACGGCAGCAACGGGCTGTCGTCCCACGACGTTTNNNNNNNNNNN
NNNNNNNNNNNNNNNNGCGAGAAGGACCGTCAATGGCGAGCACGAAGGCTACCAGCACCCCAAGCTCTCGGTCGGACGACGGGGACAACCGCCACCGCAG
AAAATGCAGACCTAGACGCTCACATTGTTGCGTTTTGAATATTGATCCATTCTATAATTTTTAATATATAAGAGTATGTGAACAGCAAGCTTTCTCGACC
TACAACAGTAGTTCATGGCATTCAATTAAAAGCGTGCCTGTCATTTATGCTATGGCTGGATGCTCTCAAGTTTGCACGGGATTCAACAACTTCAACATGA
CGTGGTTCGGGATCATTGTTGCTGCTACTTTGCTGCTTCTACTACTCGTTTTGTGGTAGGGCAACTTGCTGCCACCGCAATATGGCTGCAGGTAGCGCTC
GTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAGAGCAACGGTGTATCCTCCGACGCTCTA
AAGCCGCAGTTAAGCAGCATGCACATCCATACAGGTGTTTATACGGCTCGGGTTGATCAACCGAAAAGTGGTGCTGTACCTGTGCTCCATCTCGTTCGAG
CGGTCTCGAGCATGCTCGCAGTCCAGGTTCACCAGTCCGAGTAAATGGAGCAATGGTCGCGTCGCGATTGTGAAGAGCTACAATCAAAAAGCGTCCACAC
CAAGGTTACAATCTGACAAGAGAGAGTACTTAGGTTGCCTCTCCAAGAAATGTCCACTTGCGATAATCATCGTGAGCACTGTGAAAATCGTGGCGCTACG
AATGATCGCCGCGTGGTTTGAACCTGACACGCTCTTCACGTTCAGCGAAAGCGCAAATGCGACGGCGCCGCGCAGTCCCGAGTACCAGATCACGAACATG
TACTTGAACGGGATTGCATGCGACCGCCACAGTTTCACCACAAAACAGAGCGGAAACGTCACCAATGCGCGCGCAATGAGACACACGACCAAGCTCATAA
AGGTGAAACGCCACTCCCACTCAAACGAACCCGAGTCTGTAGGCAACCAGTATTGTCAGTGTGCTAGTCCAAGCCAATCCAAGCCCATGCAGCTGTACGT
ACAAGCAAACAGACTGATGACCAGATAGATAAAGATGAAGTTTTACGAGAGAAATGACATGGTCATGAGCAAATGGCGGAATGCCGTCGCGCTCGCTTTC
GAGATGCTGTACACGTGGTAGTAGCGAATGAACGCGCCGCTGACAGGCACGCTCAAGTGGCCAGTCAGGTGGAAGAAACTCGTCCACCAGATAGCTCGTA
TACGCAAAGAGCAGCACGACCGACACCTTGTACACCTGGTGCTGTTGGAGTACATCGTCCGCGTGCTAATGCAGGACACAAAGCAGAACAGCGAGTCCAT
TTCTTCAGTCTCAGCAGCACGTACTCCACAAACAAAGCCACTATGTACGCAGAGTAGGTATACTGACGAGTACCCAACGATCGGAGCGAGCACGAGCGAC
CCGATGCCGACGCCAATCAGTTCGAGCAACAGACTTATCGCGTTCGCAAATGTCACCTCGGAATGTCCGCTTTGCATGCGCATTTCGCACAAATTGAACA
GTACGACCGCTATTCACCAGACAAACTCACGAAAATGAAACGTCAACTTACTGATGACATTGTTGAGCAAGCGCTCACCGAAAATGATCTCCGGGATCAC
TGGCGGTACATGGCTTTTCCAGAGTATGAGCTGGGTCGCGGCAGGGTCAGTCGCTGAAACCAGCGCGCCATAGAGCATGGCTTCGGCCGGCGTGAGCGCG
ATCGCGAGCAGTGGCAAGCGTCCAAGCCAGTACAGCGATAGCACAATACCAAATTGCCACCAAGTAGATAAAAGACACAGACAAAGATACACACAAAATC
AGCCCACAGCGCATTCAGTCTCACAATGCCGCAGTGTTTAAACTGGCTTAGACGGTTGCATCGGAAGATCGAGATGTGAGTCAACATACCCCCAATGCCC
GGCACGATCGCCCAGGTCGCAGTTGACAAGTACGGTGCATGCTTGCTCCGATCGATCTCATACGTGATGCGCACAGTGAACAGCTCCAGCAGCACGTACA
CGAGCAGCTCACCACCCGTCCATTGCTGCCGCTTCAGGTTGTCCATGGCAAGAGGTTAACATTGGATTTGTGCCACGTTGAACGGTCTGGTCTGCCAACA
GCACAATCCTACAGTTAATAGCGAGCTCATGCTTGAGACGAAGATGAACAGATGCAAGTCCGTATATTTTGCAGTAGTTGAGGAAGTACTGCGAAGCGAT
CCGTTTGGCATTGTGCGCGAGCAAATGGAAGCACGCTCATTAGCTAGAGGAGACGGAGCTGCAGCGGACTTACCATTGCCGGCAATGCTTATACAAGTTT
GTGCATGCAATTCCGGCATGAGAGCGTTTCTCAAGGCCTGACAAGGGCAACGTGAAAAGGTGTTAACGGTCGATTAGGTCAGTGACGTGGCTGACGCATG
ACGCGGCCAGATCCACCAGCAAGAGATGCCAGATCGCAGTTATTTTCGAGGAGAACCGCGGTCTAATTGCAGCTTGTATCTTGCTCGCTGAGCGTATCTA
TCCCTATTGTTTTGCTCCACCTCATTCGATCCGAGGCGATAGACCAGAAAGCTGACAAGAATAGCTTAAGAAAGACGAATAGCTAGCTAGCTGCCTTCTT
GTCTAGCACAGCGCTCTCGCAGCACTTTTCCATTCCTCGTCGACTCGGCCGAAAGCAAAAGAACACAGACTCTCAATCATGACGCTGCATGGCAGAAACG
AGCGGAGTATGGCGCCGCTCTCAAGTGCACGCAGCACGACAGGAGCGGCGATCACAGCCAAGCAGCCGATGCCCCCCACATCGCTCACCGAATGGAACAA
CCTTCAGCAGCACACTGCCGGCCAAGTGGACCTCCCAAAGCTCCTCGAGTCCGTTCGAAATGCGCTCCGCACCGGCGGCATCATGTAATATACCTCGTTC
TTCGGTTCCGTCTTCCCTGATGGAAAAGCGCTTCTAACCTGTGTGTCTGCGTGCGAATTGTACCAGGGCGTGGGTGACCTGGGGCTTGAATCTCGACAAA
GCGCAGAGTGCTACGCATAGTGGTGGACTCGGGAAGGGGTCCGTCAAGCGCGTGTTTAATGAAAGCAACGTGATGCTCTCAGACGTGGTACGTTGGCGCT
TTTGTAGCTCTTCATTCTTCATGTATCCAGCTTTTGTATCTGACCACCCGACATGGACAACTTGCATGCCACAGGATGCCCGCGCAATGGTCCAGTGGCT
CTCTCAGGACGACAACGAGCACGGCAAAGTGTCTGCCGACGCACTTAAGGACCTCGTGTGCGGTCCGCTAGTCGGTAAACGCCTGGAGCTCGTGCAAAGC
GTGTTCGAGCAGTTGGACCGCAAGCGCGTCGGGTACATCGCTGTGTCCGACATCCTCACTGCCCACGACGCGCGCAAGCACCCAAGCGTGATGTTTGGCG
AGAAAACTGTGGATCAGGTCCACGACGAGTTTCAGTCGTCTTTCCAGGCCGCAACACGCCAAGTGGGTTCGTCATTCGTGAACCTGTACCAATGGTTGAG
CTACTTCCAGTATGTGGGCGGTCACGTCCCGAACGACGAGTACTTCGAGCTGCTCCTGAAGCGCGTCTGGAAAGCCACGAGTCGCACATCGCTCAGCGAG
GCTACGGGCAGCAACCTTCAAGCCTCTGNNNNNNNNNNNNNNNNNNNNNNGCTGGCAGTGGATACTCAGTCGAAGTCGCGCCGATGACGTTGCTGCAAGC
ACTCCAGGAGACCAACCCTGCAATCGCAGCCAACTACTCCAAGCGGCCGCTGTCGATCTCCACAACCTCGATGCCACCACCCGTGCCTTCACGGTTGCAT
CGCAATACAAGTGTCACGACGGGCAACGCAACGCTAAGTCCTGATGTCGCGTCACCGCGCGCGACTCACACAACGACCGAGTTTCTCAAAGGCACGCAAT
TTGCAGCATGCATGGTCGATCCATCGATCCGCCAACCTTCTCCGAGCCATTACACACTTGGCAAGCGAAGCGGATCGTCTACATTGTCAGCATCACCACT
GCAAACCGCGGACGCTGGCACGACGTCGGTGCTCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGCGACGATCA
AAGAGCGCGGACTGCGCGGTCTCGTAGCGCTCAGTCGCAATCTTCGCCTGAGCGATGCCGACAGCGACGGACTGCTTACGCTCGTTGAGTTCAAGAAGGC
GCTCAAAGGTCTGGACTCCGTGCCGCTCAGCGACGTGGACTTGCGCTGCTTGTTTAACCACTTGGACCAGGACCGACGTGGCATGGTGTCGGTGCTTGCG
GCACTCGACATGNNNNNNNNNNGTCCATTGATCGCGACGGATCTGGGCAACTCGATGCGAGCGAGATCGTGCAAGCGTACGACGCGAGCCGTCACCCAGA
TGTGATCGCAGGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN