Description :
From Genome Similarity Track
Location :
Scaffold_230:5036- 6425
Sequence
1389 bases(100 bases per row)
CTCGCAAGTAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGTTCCCAAGTTGGATCCTTATAGCCAGCCCACTTGACTTTGAACTCGCGTAC
AGCACGCTACGTGCTCGTCGACGTGATGCTCTGTCGTCGAGGATGGCCTCGACTTCATACTCACCGGCAACTTGATCTGGTTCCCAGCTGTCTTCAGGCA
ACAATTACTCGTCGAAATCGAGTCTTGCTTCATTAGTCGCGCCTAGTACCAACCGAGGCTTTGGTGGACTGCTGAATTCGTTGACTGCCTTGAGTCTCGA
CACATGCACCACTGGGTAGACGCGGTATCCACTTCGGTCCGGCAGTTCCAGCTCGTACGCAAACTCTTCCACTTTGCGCTTGATCCAAAAAAGTCCATGC
CACCGATGAGCTAATTTCATCATCAGGCCTGGTTTGACGCGTTCCATGTACAGCCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCTTG
CAGGATCTTCCATCTCTTCTGAAGCTTTTAGGGGGTCCACCGAGTGTTCATTTCCACTTGGTTGAGGCACAGCAGCTTTTTCCAGTCGATTCAGGGCATC
ATTATGCTTTTTGTCCGTCGCTCCTTTTCTAAAGCCTGATAATTTTCGGCCATAGAGAGGGCGATATCGTGTTGTCGATTGATTTCGCGCCGCCACGCCA
GTGCGTCGGACTGCTTGCCGAATACTCGTTTGAGTAATGACGACATCGCCCGCAACGTCGACTGCGCATCACAACCGTGAACGAGGTAGAACGGTGTTTC
CTCCCTCGTAGTGTCCTGAGAAGTGTTAATAGCGAATACCAACTTCTCGGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACG
AAGCCCATCACCGACTTCACCGAGCGTTCCTGATGTCAATTAGCCTGTGGTCGATAGCTCAAAGTTGCTCGTGATCTTGACTGCATCATGGCTGCAAACG
CTTGGAAAGTCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTGATCAATGATGGGGCTACGAGCCCTCGGTACACACATTCTTCGAACACTTGAACAAC
ACTCAGCGCCGTTGTATCTGACATGGCCTTGGCAATAACGAATCTCGTGAACGAGCGCTGAAATAGGAGCAACGCTGTGTTGCCCTTGCGAGATTTCGGT
AGTTGGATCACAAAGTCCATCGAGATGATCTGAAACGGTCGTCCAGCTAGTACATTGCCAGGCGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGC
TGCAATCCGGACATGACTTCACATGCTTCTCCACGTCAGTGTACAAGCCGATCCAATAATAATCGGACTTAACACGGTGGAACGTTCTT