Description :
From Genome Similarity Track
Location :
Scaffold_1275:5034- 7219
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1275-fgenesh-gene-0.1HECT E3 ubiquitin ligase

Sequence
2185 bases(100 bases per row)
TGAAACTCACGACAAATCCTGGGAAAAGCAATCTGTCCGCAGCTCCACGTCTGAACCAGAAGAGTTTGCCTTCCACGTCCAGCTTCCTGGTCCACTCCTT
TCGTTGCCTGCCACATTTAAAGGGAGAACCCATACGGATGAGAAGACCAACAGCAAGGCATGCTCAACTCCAGGACAACATAGCCACCTACCGAGCTCGA
CGCTGACGCGCGCCAATGACGTCGCGCTTGTGGAAGCCGCGCGCGTGGCCCGCCGCCTTGTTCCTCTCGACGAGCGTCTCGAAGCTCGTGACGACAAAGT
CTCGGTCGGACAGGAGCAGTCTGCAGCCACATACCGTGCAGAACACGAAGCGCCGGAAGTTCTCAAAGCCGCAGAGCGAGCACTTATAAAAGCCCTCGAG
CGCATCTCTAATGCATCAAGCATAGCACACGTACATAATCGAGCGATTAGTGACTCAGCGTAATGTAGAAGATGCCATTTTTATAGCGCGTACCTTTGTG
CAGCGTCCAGGCGGTGCGTCAATAGCCTGTTGAATGCATGGACAACATGTGCAGTGTATGGCTCGTTAGTGCATTCACACATATGTTGGCAGTCTTATGG
TAACAGACGTACGTTGGCGACACTCCTTCAATCAGCAGCGGTGCATGAAGCGCAGCGAGCGGTCGCTCCAGCCGCGTGAGGCGGTGGCGCACCCAGCGCC
CCACTTGCCACGCGAGCGCGAGGCACGCGACGAACACGAACACCAGCGCGACCGTGGCGTTGTTCCTGCCGCTGCTGCTGCTGTCGTCAAATGCCATGGT
GTCTTGGCGTTGGGCTGCGCGCGGTCTCTGGTAACAGGGAAGTGTTGGAGTGATGAATTAAAGTCCGCATTTTGCATTTGCATTTAGTTTTGACGCTTTT
CCTTGAAGTGATTGAGTGCGGGTACGATGGGTGGGAGGGACGACGCGACGCTGTTGCTGGTCAACATGCAGGAGAACGGGAGGGGCGATGCTTATCACCT
GGGTTATACTACTGCAATTTGCTGTCACAGAGTGACCTCTGTCACTGGGTTGGATTGGGGAGACAGACGGCATGCGGGAGATAAACACTGCCGAATGTGC
CTCCATGAGTGTGCCTGCATGTTGTACTGTAGGTGTGGTGGTCTGAATTCTCATGATGTTGTCGTACGGCTCTGTCACAGGGTATGCTCCCTGGCGTGAG
GTCATCACATCGCATGTAGGGAACCTTCTTCCCAAATGCAGCGAAGTGGAACCAAAGAGGGTATGCCCTGAAACCCGATACAGAGATTTCGTTCGCCTCC
TTCAGATTTCCTGCGAGGCATGTATCATAACGTTGGTTTTCCCTCCTCTCCTATAGTATAGCGCTCGTTTAGCTTCCTAACGTCGTCGTGGGCCATTGCC
CAAAAGGCGAGTCAAGTGAGGAAGAAGGCGAATGCAGAGCATCACGCGAGAGCCGAAAGTGTTTCCAAATCTGTTCGAGCCGCTTGTGACAAACTTGACA
TGAGGAAGCTGGACGCAGAGCACACATACTCTATATGCAGAGGGCTGCGCGAGGTTGTATGCACTTACTGCTCCATGTCGCTCCTTGTCCTGGAACGCAA
AGGCTGTACGCACAGCGTGTAAGAAATGCCTGTGCATGATAAACCGCTATTATTGCAGTGAGTTCAATCGTGGTTTAGTCAGCCTCTTATAATAACAGCA
ATATCGTAAAAGGATAAAAACATTCACTGAACAGGTTGCTCAGTATCGCCATTGCACTCACTATACTCCCCAAAAAGCAAATCACAACAGCATTTAATTA
TGCTAAAAAGGCTTATGCAAGATTTGGTTTCTGCTCGAACTGAATTTCGAAAGTATGTTGGCGCCTGCCTCAAAGTGGACTTATCCACAAGTGCCTGTCG
CCAGTCCTCGGTTTTTATCCATCAACTCTCTCTCGCCAGAGCCGTACGAAACTAAACCCCCACATCATCTTGATCATCGTATCGAGTCCTGAATGCACGA
CTTCTCGTCTACTGTATGGCTGGCGCCCACCTTGGAGCTTTCCCTCCTTCTCTCATGCAGATCTGGCCAATCGCGTGTTGGTGGTGCGACCCCTCCTCGT
CTCGGAGAGAATCCGCTCGCTTTCGCGTCCGTGTCATGCCTCCCGTCTCACAATCTGCATTGCAACCTTATCCTTACATACCAAC