Description :
From Genome Similarity Track
Location :
Scaffold_98:50316- 51868
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18987tubulin-specific chaperone D

Sequence
1552 bases(100 bases per row)
GACATCGAAATATAAGCTGAACGTAGAGCTAAAGTGGCATGTTTAAAGCATCCGTTGGGTTATCCGTACCTGATTGTTAATTAAACACTAACGGTCTTTG
ATCGTGAACTCTCGCAGGGTTACTAGCCACACATTTTCTCTTCGTGGGCGTGTTGAAGTCTAAGCTGCTTGGACTCGCAAGGACTTAACATCTGCCGTGC
ATCTGTGCGGGGACATTTGGTGATCTAAAGAAGCGTCGCGATTACTACTATGTCACTTCTAAAGGTTCGTGTGTATAATTGGTAACGCAACACCATCGAA
ATAAACAAGTATAAACTAGCCCAGAAGGCAACCTTAACGCAGATTACCAAATCTTTAAGAGGAAATACCTTGAGAAACACTAGCAGATAAAACTTTTTGT
GGCATCCGTTCATCATTGCATTTTTCTGTCGGCTTAATCTAGTTTACCCTTACAGATTGTATCGCACCACGAGCCGTTGAAGTCTGGGAAGCAAGCTTTG
ACACTCAAAGATCAATACAAGGCTAACTTAAAGAATGATTTACTTGTACTAGCCGCAGGATTACCGCACTTGCAAGATGGTTTGCAGAGGCAAGTTGAGA
TTAAAATTACATTTTTTATCTAGAACCTAACATCTCTAAAACTACGCGCTTGATCTATTTCGTCGCTTCGCTTGGGGCTGATTCGACCCGTGAACAGCCT
ACGAGCGCTTGATAAAAATGTGCAGCACTAAAGACTCCATGTACGTTTGGAAAAATATCTGAAGGATATCATTTCATACCCGACTGGCTTCCTGTAATCT
GATTCGAGCTTTACCACACGGAGTTGGCCCCTCGAATGAAGTTTGGGATTTGTGCTGTGTGTCAAAATTTGTTGGACTGTCGGTCTTCAAGGAGTGTAGA
GCCTGCGGAATAAGGGTTCTACTAACAGATAATATTGTACTATGTACATTCAACTACGCATGTGACTGAATCTAGTATCTATTTCAAATATCTGTCACTA
CATAAGAATAAGTGTATTCCCAGCTCAGTCGATCTCGTAAAATAAATGACGCGTAGATTACCGACGGAAATATATTTCTTGCACTATTTTTAAATTGCTT
GGTCCATTTTAAATTTCATGCGCACAAAATAAAATACCATCGCATACCGACGCAAACCGACGCGGGTCCCGCGTCGATGTATGGGAAGTTAAATTAGAGG
CATACTGAAACCAAGATGCGGGTCCCCGAAAAAAATAGTCCCGTAAGAAAAATATATTGCAATCTTTGGCAAACGTTATGCCAGCAGAGCAGCAGGACGA
TGGCGCTCCGGCGGGCTTGAGCTGCAGCGAGCGACGCTTCTTCGAAGAGCGCGAGCAAGTGCGCGAGCTGCTACAGAAGCTGGCGCAGACGCGGCTCCCG
ACGCCACAGAGCGACGTGGACCGCGAGTTCCTGGCAGCCCACTCGACCGTCTCGCAGATCGTACGCTCCTGCTGGTTCTTTCTCCTCACTACGTACGACG
CAATTTCACCTCTAATCGTCCTCTGATCATAGCTGGACAGATATTTAGAGCA