Description :
From Genome Similarity Track
Location :
Scaffold_46:50314- 51525
Sequence
1211 bases(100 bases per row)
GCCAGGGGTGTGTGCGAACGTAGTGCGTGTCACATTTCTAAGCGCCCACATACAATTAGTAGCACTAGTAGCACTTCCCAAGACCCATCTCTCTGTGAGC
GTGTCAGTGAGGATGAGCCTCATTGTTAATAGGAATCAATTTGTTCTATCTCTTTCAGCATCAGAGGGGGGTAGCTGATCATATGTATCGGGCACCTGGC
GAGGAAGCTTTATTCAATTTGCTAGTTGTCTACCAAAGCAACAATGCTTCTCAACTGGAAAGTTTAAAATGTTCGTGCTCGGACAGCGAATGTCCGCGTC
TGAGACACGAAGCCATGAAATTGTGGGTCCGTGATGAGCTTCTGCGCAAGCAAGCTCGGACTGAGGCACTCAACAGGACCGTTGAGATGCTTTCGGCCCG
GTCTGTTCAACCAAGGCCTTTCAGGATGGACACACCTTAGTTTGAAAGTACTGCCGCACGCATTATCGTACAATGGCTTCTAGCCGTGGAGCATTGTGGT
GTGGCACAATTTATCGAGGAAGATACCAGAATGGTATTGTACGCTATGTCCTATTTGCAGTGTAAGGCATCATAATAAGCTTACTCGGCGCTTAGTAAAG
CATTTTTATCATGTTTGATCTTTAACACAAAGATTATTGACGTGTATCAGCCGCCGAACCACGACGTGTTGGCGCGCTTCTTTATATCACGACAGGCTCA
ACAATTATCTGCAATCCTATTCATAGGAGATGCGCTCGCTGTAGAAGTACATTAGTTGAAAAAGAATACATTACGGTGCCCATGTTCCTATATGGACTGC
GTCACGACCCTGCACGACAGGCCCATTTCAGTAAGGTGCCGTCAACAATTAAAAAATAATTGAGACTGCTGTAGTTGAGGAGCAATCCTACAACAGTGCC
TTAGTAACTCCTTGGCAAAAGTAGGCAACTGAAATGTATGCATCCACTGTGGTGTAATTAGGCGACATAGATATTGTCTGATACAACTGTGACAAGGACC
TCCATACTATGGCTGCTATGCAAAGTGGGCGCTAGCACGAAAGCGACAAGAAACTTGCCAACCCAAAGTTGGTACGGAGAATAGTGTTAAAGGCTTTCGC
ATTCGGCATCGACCAAACATGGTCCGGGAAATGAAGTGGTTCAGTAGGGGTGAAATGCCCTACTGACGCGGACAGTGAATCTAGCTAACGTTCAGAGTTG
TCAAAAAAGGT