Description :
From Genome Similarity Track
Location :
Scaffold_4:5029808- 5033150
Sequence
3342 bases(100 bases per row)
CGAGCTACCCAGAGTAGGCTGCCCACCAACGACTGAAACTTCTTCACTGTCGCAACCGCGGACGCACCGGAGATCGGCAATTTCTCCAGTTCGATGTCGC
ATCCCGTCACTCCATTCTAGTCCAATCGGCATCCGCGCTCCGTGCGCCATACCCATGCCAAACTCATTCAGCATCTCTGTGATCGTGATTTCTTGGTCGA
GATCGTACCCATACGACTCATCGTACACGACTCTCATCCCGAGAAACTTCCTGGCCTCTCCCAAATTCTTGATGGATAAGTCGGCAAGTTCAACAAAGAA
CGCATCCACTGCCTCCAGTCCCGTTCCGGTCACTAGTAGGTCATCAACATATACGCCGACCACCAGTACTTCGCGCCCGTGTCGTCTGTAGTAGACACAC
ATGTCAGTCAGGCTTTGTATGAAACCAATCCCTTTTAGCTTGTGGTGCAGGAGCTCGCTCCAGAGTCGCCCAGCTTGTTTCAAACCGTAAAGTGCTTTCT
TCAGCTCGAGTACCACCTCGTCTCCATGTCTAACACCCAGTGACCTCTTCATCTCGTCCGAGATCTCCATTCCCTTGGGAATCTTCATGTAAATGTCCAA
ATCAGCATCTTTATCAGCTTTAACGTACGCGTTGGGGACGTCGCCATGTTTGGCAGGCACGCCTTACTTTCTGGCCAACACGAGAATCAACTTTACGCTG
CTCATGTCCATCACCGCAGCAAACGTAACACTATAATTGACGCCAAAGATCTGTTCGTTTCCACACGCCACTAAGCGAGCCTTCAGCCGCTCAATCGCAC
CTTCCGCATCCAGTTTAGGCTTGAATACCCATTTTCCGTGCAATGCGTGTGCTCCACGCGGGAGCTTCACCACCTTCCACACATCATTCTGTTCGAGAGC
CTGCAGCTCCTCCGCGATGGCCCTCAGCCACCGCGACCGGTGTCGACTCTTCATTGCCTCTCGGTAGTTCTTTGGGTCCGGCTCCACTAAACTGTTCACC
ACGTCGGGCGGAGTCTCCTCCTGACCTCCCAGGTCTGGGCCGACTCCTCCTGACCGTTGAACTACGGACCGCGTAACTGGGCGATCCCTAGTCCAGTTCT
TATTCGTCCTTTTGGAGCGCTTCTTAGTGCTCCCACTCGCATTTCCTGCCTCGGCAGGTGCCACATCGTCCTCGGGCGTCTTCTTAGCAGCTTCCGACTC
CTCCTGAGGTACGTCCTCGTCGTCCTGCAGGTACAGTCGCTGCACTTTCTCGTTCTGCTCCTTGTCGAGCGTCTCTATGTTCTTCACGTGTTGCGTCACG
ATCACGACCTTGTCCTTTGGCAAGTAAACTCTGTAGCCCTTTGTTTCCTCTCCGATTCCGACAATCATGCCTGCCTGCGCTCTCTGTGCAAAGTTTTGTT
TCCGCGGGTCCCTGTAAACAGTACATGGGGATCCGAAAACAACTATCTCCCCTAGCTGCGGCGTCTGCTTCGTCAGTACTTTAATCGGTGACGCACGCCC
TGGGTTGGAGCTGGTCGGGGACCGGTTCAAAATGTACGCCGCGTATCTAACAGCATCTCCCCATAAACTGAGAGGAAGCCCGCAGGCAAACACCATGCAC
CTGGCCATATTCATAATGGTCCGGTGCATCCTCTCAGCCTTTCCGTTGCTTGCTTGGTTTCGCGCCTCGCTGCGCTGTCGTGCGACACCAGTTCTCTTGC
AAAACAAATCTACGTTTTCGTACTCACCTCCGGAATCCGTTCGTAAGACGTGAATCCGGCAGTCGAACCGTTTCTCGAAGTAGATGAGGAACTCTTCGAA
CTTTCTTGCCGCTACATCCTTCGTCTTGGCGAGAAACACCCCACAATAGTTCGACTTGTGGTCGACAAAGTTTATCATATATCTGTTACCCAGCCGATCT
TTCGGGGTCATGGGTCCTTTAAGGTCGGAACAGATCACGCCTTGCACACGATCTGTGGGAGCATGCTCACCAGAGTCCTTGCTCGATTGTCTGTTCTTCG
TCTGCTTACCCTCGGCACAAGTCAGACAGTTCACTCTTCGTCGATCGGTCAGTTCGATGCCGGAGCTTGGCTCGCGTGCCAACCGCTCCACGGCATCATA
GTTCAGGTGCCCGAGACGTCGATGAAACTCGACCAGCGTGCCCTTCTGCACATTGCTCGTCTCGCCGTCGGTCGCCGCCACCACCTCAGTGAGCGCGGCC
ATGATCACGTCTGACGCGAGTTCGCGCTTCTTCTTTACCGATCCGCACACAATCAGCACGTTCCTTCGTAGCTGAACGTCAAAAGCCACACGCTGTCCAT
TCTTAGCGGCCACGACGCGTCGTCCGCTCTTATAGGTCAGTGTGAAATCTTTTTCGTCTAATTTTCCGTACGATTTCAAATTATGTACGACGCCCTCGGC
GTAGTACACGTCCGTAAGCATGAGTGTCTGCTCGGCACCGCATGCCGAGACTCTGAGTGTCAGTGTGCCCTTCTTTCTTATGCGCAACGGCTCACCGTTG
GGCTGCACACACACGTCCTCGCACTCCTCCACTTCGTCCAGCCAAGAACTCGTCACGGACTAGATGTCTACTAGAATCACTGTCCAGGATCCACATTTTC
CTCGGTCGCAACCGGTGTCTTCCTTTACGGCAAGGGTCAAATCCGGTTCCCCGTCGCCTTCTCGCCCACGCCTCCGGACACGCTGCCCCCAGATGCCCAA
CTCGACCACACTCGTGGCATTTACGCGTTTCCCTACCACGCGCGTCGCGAGCCGCTCCCACCAGCTCTTTTCCAAGGCTCCGGTGCCTTACCGGATCTAA
CTCCCAGGCCTGCGCGAAGTGAGCCAGTTCTTCGGCTGCTGCAGATAGTCCGTCCTGCTCGCATCGACCTTGGCCATTAGTACCGTCCGTAACTCAGGAG
ACGCGTACTGCACTATATTATTAAGTGCAAGATAGTCAGCTCCGCCGCCGCACGCCTCGGAGATGGCTACGAGGTACATGTAGTGCTTCGACCAGTTGCG
TTTAGCGTCCTTTGGTGCAGTGAAGAGCTTCATCGCCTGCGCAGGCGTGATATTCGTCTTAAATGCTTCCAGCATACGTTCCATAACGTATTGCAGTGTG
GGTAGTTGCGCCCACCACATGTCCACTTGCTTATTGTAGTACCGCTCCGCGGTTCCGGACAGGTAGTGTCCCAACAGGTCCACCTTCACGTCCTCAGACC
ACCAGAACCCACAGGCTGACTGCGCAAGCTGTACTTGGCGCTCGAAACGGCGACCCCACTCCAGGAAACCCGAGCCTAGCCCAACGTACAATTCTTTTCC
ATCGAATGGGCGTATCGACAGCTTCTTCTGGCGAGCATCTGG