Description :
From Genome Similarity Track
Location :
Scaffold_115:50286- 59076
Transcript NameFunction/comments
Phypl_g3471hypothetical protein PHYSODRAFT_313159
Phypl_g3472hypothetical protein
Phypl_g3473conserved hypothetical protein
Phypl_g3474hypothetical protein
Phypl_g3475Di-N-acetylchitobiase, putative

Sequence
8790 bases(100 bases per row)
TGTCGGTCACCAGGGCGTTGTGACCAGTGCGCGATTTAACCCGAAATTGCTTGGTACGTCGATCAAGCGGCACGGGGATATCAGAGTATCGATCGTGGTG
ATGATGTTGCTTTTGGTTTTGCTATGCAGTGACAAAGGCAGATCCGGATAAGGAGTTTGCATGTTGTGCTGTGGGCGGTGAAGACGCGACTGTAAGCATC
TGGCTGGCACATCTCGCTCGCCCATTGGCAGTCATCAAGGATTGCTTTGACTCGTCAGTCACGGACCTGACTTGGTCTAGCTCCCAGTCCCTCCTCCTTG
GCTGTTCGCTCGATGGTTCCATCTGCTGCTTTCAGTTCGCAGGCGACGAGATTGGTACCCCGATCTCTGCTGCGCAGCAGAGTAAGCTCCTTCAGGCAAA
GGTATGTTCCTCAGTATTTGCATGTTATAGCATGTGGGGTCTAACACTCCCTTCTTGATTCTTTGTTTGACATAAAGTATGGATCCCGAGCCGGCATTAC
GCTTGCATCAACTCTGGTGGAAAATCCAATTCAACTTCAGGTACGTCCAAGCAGTGCCAGTTGGTGTGGGACGAGGTAGTTACCGAAATGAATATGCTTT
GCTGTGTCTAGCTTGAAGAAAAGTCGACGACCTCGCCACTGTTGACTGTCAATCGGAATTCTGGGaccagcgcagcgccgaTCGTGACGCACACAACAAA
CACACTCATTccaaagaagaagaagcttgGCACACAGGCATCCAGTACACTGCCACCAAGCGGAGCAACTCAAAACGACAAAAAGCGGATCGCCCCAGTG
CTACTTCAAACTGACGAGCAGTCTTCAGCCAACAATCCAGCTTCATCGCAGAACAATATTCGCAATATCTTGGGCCCGACGATCGTGTCACCGACAGCGT
CGGACGTTACACTCTTGGATGCTCGCATGGCATCAACAAGTGGAAAGGAGGTTAGTGTTGTCCCTGACACTAACAATTCTGCAACGCTCCAACCGAGCTC
CGCGCCGAGTCATAGCGAGAAGACTGGGCCCGCCTCCAAGGAGAAGCATTCTCCGGCGACGACAAACGGCGCACCGTCTAAGCCGTTAAAGCCGGAAGTG
AAAAAGAATGGAGTTGATGGGACTTCTTTGAAGAGAAAGCGAGAAACTGAGCGCACCCCAACCCAACCCGCCACAGTGGTTGCGAAGTCGAGGGAAGTTG
GCGTGCGGCCACCGAAGCTACTGAATGAAAGGTTTGTTGAATGCCGTGTAGTATTTGAAGTGGTACAGCTACTAACTCGCGATGCATTATGCCTTGCAGT
AGTGCTGGCGTGGCCAGCGGAGGTCAGTTGTTACCTGAATTCCCATTCAGACTGCAGTTCTCCGTAGAAATCGATACGAGCACACAAGCTAGCACTGCAA
ATGCCAGCTCGAATGGCAGAGCAAGAAGTGTCGTGGCGTCTTCTAAAGCGGTGATGGAAGTTATTGTTCACAACCTGAAGAATCCTCAGCCACAAGAAAT
CATTGGTGAGTTGCGAGTACTTGCTTGCCGTACATGAACGATCACTGATGCTTTTGATCCATTTGCTAAACAGAGTTAGGTCCAGTTTATTCAACTATTA
AATGCTCCGAGGGAAGCGAGGTCAAGTGGATTGACCGCATTTCTGGCCGAGTAGTGTGCGCAGTCGGAAATGCGAGCTATTGTGCAGTTGGTGTACACAA
CGGCAACCTTCTTATTCTCAACAGCAGCGGACGACGACTGTTTCCGTACATTGGTGGGTATGCCAGTTATTACTTGTGGTTGCTCAGAAACTGACGCTCG
CCGCGTTGATGATTACCAGCTTTGGGCAGTGCCATCTCAGTAATGGAGTGCAGTTTGAGCGAGTCGTCGTATCTCCTTGTGATCCTGGCGACAGGCGACC
TGAAAATATGGGATCTAGCCGAGCGTAAACTCGTGCTCTCTAGCTCAATCGAGGCGATTACGAGTGTGAGTTTGACCCTGAAATGTCTGGGGCATGGCGC
TTTGATTCTGAATTTCCATTGTGTATTGTGTCGTGTAGATTACCCCAGCAGACCATCGGAAGTTGACGCTTCTCCGGTGCCAGGTGACGACAAAGGGATT
GCCGCTTATTACGTTTGCCGAGTCCAACTCCGAAACGAAAAGCAGCTCTAGCTTGCTCTCCTACACATTCGACACTGCAATGGCATCATGGTACGGACTT
GGTAGAATGGAAATTATATCATGTACGTGGAAGTTGATGTTGTTATTCACGTACTTCGATCATGTGTAGGATGCGAGTGGCGGACGACAGCTTCGTGTTC
TCGGACTTTGCGTCTGCTCTCCCGACGGATGCAGTCACGGTGAAAAGCGTCCCTGTACGTGCACACGTTCTTGTTTGTGCTAGCTGGCCAGGTGTTCTGA
TAACTACGGCTTTACATTGCGTTCTACAGATCGGACCACTACGGCGGCTCCAAAATGCATCCGGCTATGGCCGGACTCAAAGGGGAATCGCGTCGGCAAT
GCTTTCGGGGATGTCAGATCCGCTGATGCAGCGCAACGTGACGCGCTCGCACCTCGAGCATCAAGTCGCCGCTGCGGTCGTCCTGAAAAGTTCCGCCGAG
TATCGCTATTGGTACTCCCGCGCTCTGCAAACGTGGCCAAAACCTTAGTGCTTATGATTTCTGAAATGCGTGATTTACCACAGGATTCAGGCGTACGCGA
GGTTCCTGACGCATGACGAGGACGTGCCTCGCCTGGACAACCTGTGCGCTGAAATGATGGGCCCCTTCCACGCGTACGTTTCTGTTGATCTGCTACCGTG
GTTGCTGTATGTTAAACTAAGCGCCATGCGTTCCGTCCTGCAGACCGTCATCCCCAAGCGATTGCAAGAACTCCAATTTGGATGAAGGTGGCGAGTGGGA
TCCGATGGTCTTGGTACGTCTGGCCTCTGCATGTCGTTTCGTTAGCAATGGCCAAGTCGCCATTGTGCCCCCACAACTGGCCCCTGACTTGGATTGATGA
TAGGACCTCGTGAAACGGGACATGTTGAAGACCCACATCCTGCCTACGATCGCGGTGAATCGCGCGTTGCAGCGTGTGGTGGCCAAATACCAGCTCATGC
TGAGCGAGGTTGAAGCCcgcgagaaggacgagaacgagtcTTAGCAACGGCGGCTTGAGTGTCGGTAGGAACTGCACCCATCATAGACCATTGGAACGGA
TAGCAAGGTTCTCCTTATCTCGGAACGCTCCTCGTTCTTGTAGTGTTCAGCGACCACGACTAGCGGCATCCTCCATTATGAGGTGCCAGAACGGTCCGGT
TACCGTGCTGCTTCCGCCCAACGCCTGGATTAGAAGCCGGCGGGTGCGTTTCGTTTGCGAAGTGGGCATCCATGAGGTAGCAGTGGCGCACGAAGCACTC
TGGCTCGCCCCGCCGCGCCGAGCGTCTCGGTGCAGCAAGCGGCGGCTCTGCAGACGGTCGACATGAGGTACTTCTTGATCTGCGCCTCGCTGCGCGCGTC
TGCATTTGGCCTTCACTCACTCCATCGTTCATGTGTCGTCATGCCAAGTGAGGCAGTGCTGTACACAACCATTGCTGTAGTGCACCGCCATCGACATGAT
CTCGTGAGCGACTCGTTAGCTGAGCCTGGTGCAGGAACTGCAGTGCCCGCAGCTGTACGCAGGATTCAGCCCCCGTGCGTCTGGCAGCCGATTTCGTGCG
GTGCGTGGGCCCAGGTCCACATTTGCGCTGAAATCGACCGGCACACCTCCGACGCACGCTTCCGCATCGTGGTGTGGATCCTGGAGTCTGGTGCAGTCGT
TGTGAGCGACGTCCTTGACATCGGTTGCCGCTGGTGGCAAAGTGCTTGCGACGATAGGGCCTTCTGCCGGCTCACAGGTGTGGATGGCTTCACTTACGGG
TTTCAGTTCCGTTCCGCGACGAAAGCTGCCGAGTGCTCGCGTATCGTTGATCATGTCCTCACCAACCCGGGTTGGGAATGCGAGTGCAACGAGCATTTTC
ACTGGATCCTTTCCTAATGACACGTGTGTTTGCTCTTATGTAGGGGTCCTGAAGGTCGTCAGGAAGCTGATGCGCGCAAATGTTGATTTACAAGGCGTAC
GTCGTCGATACTTCCATGCTGTGAGATTTGAAATACCCTGCTGACTTTGCTGTAGCTTGTCTTGGCGTGGCAGGGCATCAGCTTACACGCCATTCACTAT
CCGTCTCGCACTCGCATTTATTCAGAAACAAGGTCTCTGACcccttcgtcttcgcctccttcaccaTCGCGCTCGGAACCAAGAGCTGGTCGACGCACAA
TTTACCCTAAGCAATGTGATGAGGTAAGTTCCCCGTGGAGTggagacgagcagcagcaacaagcagaaGATGCCAGAGCTTTACAGATTCCAACTGACCG
GGACAGTACTACAGCTTCGTCCGAAGAATCAAAGAATCCGAACGCAGTTCTCGGACCGGAGGACGATTCCTCGTTGGCAGGTGACGAAGAGAACAACCAG
GAAGCTGATCATTCAAACGAAATGCCTACCTCGCCTGTCGCCCTGCTTGAGACTGGTGGGGCCATGGACATGGAGACGCGGTTTACTTGTCTAATGAGGC
GTTCGCATGGACAATGGATCAGTCGTCCATACAAGACTCGCGGGGAGATACACGTCACTTACGATGTGGATCATGCGCGCTTCGAAGGATTACCGGATGC
GTGGCGAACTCTCAATCATCAGTTCGGGCTGCCCCTCGACAAGGTGCCGAGGCGGGAGATCGAAGGGTACGAAACCAAAGTACCCGCTGTACTGGAAATG
ATGAAAACCTGCTTTCTAGCACACGACGGAGCTCGAGCGGAGGGAGTGTTCCGCCTGGCACCAGACAAGACAGAATACAACGCGGTCAAGGCTGCTATCA
ATGACGGATCGTTTGAAGACTGCTCCGACGTCCACATCATGGCCTCGCTTATCAAGGTTTTGCCGTCGGTACTGGGGAAAATGTGTTGTTGATTCATGTT
GGTCTCATTTTCGTGTGCTGCATGCAACCAGGTTTGGTTTCGAGAGCTCCCAGTAGGTCTCTTCAACATGCTCCCAAAGAAGCAGATCGCTCTCGCGTGT
GAGCTCGTGGTAGGACTCACTGGCTGCAGTACGGATTTGAGTTTTTCCAGGTGCCGTTATTGACCGTTGTGGCGTCTTTTTTTGCCATAGAACCCGGAGC
CcccggcggtgctgcagtcccTGTCGACTCTGCCATCGCTGCATCGAAGCGTTGTGCTATGGCTGCTCGACCTGCTGAATGAGGTCGTAAAGTTCAAGCA
CGAGAACAAGATGACCGCTAAGAGCATGGGTTCGTCCCGTATCGCTTCCACTGGCGCATTCATGTCATTGgcttgaccttcttcttcttctgcgatGTGT
ATCGCAGCAATTGTCATGGCACCGAACCTGGTCAGTGTCGAGAGCTCCGACATtgcggtcgtcgtcgcggcgTACCGACAAGTTGCTGACTTTGTGCAGG
TGTTGCTGCATGCGCGACTGCGGCAGCTCTCGACTATGTAGATAGATGGCAAGGTCTTTAGCGAAGACGGTGGATGCAAGGTGGCGAAGTCGTTTTTTTA
TTGATATCGTTCGTTCGGAATAATTTAAAGCTCAATGCAAAGAGGAAGAGGTGCAAGAGGTGCAAGCAAGCAAAAAGAAGGAGACCGCGGAGTGGACAAA
GCTAAAGCACATCTACATCTAACCGAGCAGAGACTGCTGCGTCCGTCTAGACCAGGCAGCCGTACTCGGGGGAGATGTGGCGGAAGATGTCGTCCTCCAG
ACCTTCCAGTCCACGAGGCGCGatcgacgccgacggctcTTCCGggttcgaggagctgctaGCTGTCGAGGTCTGCTGcgtcacggcggcggctttCCGC
ATGGCCATGGTgggcgacggctgcagcggGAAGAAGTCGTACGAGACGGCGTCCAGGGAGTAGCCGCACGACGGGTGGTCGTTCTCGCCGTACGGGTCCa
tggtggaggtgctgaGCTCGCCGAAGGGGTCGTACAGGGTGTCGAAGACAAAGCCCGGCTGCGCGGCGGGGAGCATGCCGGCTTGGCTGTACTGGCTGTA
CTGCATCCGGCTGTACTCGGCGGCCGCACTCATGGCCATGGGGTTGCCGAAGAACAAGTTGTCGCGGTGCGGCGAGGAGGCtgaggccgaggacggcgag
tcTGTGAAGAGGTGCTTGCGCGCCTTGTTCCTGTGTACGAGGTGCTCGGCGCCTGGCCGCGGGCTCTGCGAGCCGCAcgagtcctcgtccgagtcgtggT
CGTCCGGTGTGTGGCTgccgtcggcggcgtcgccgacgaagaagtggGCGGGCAGCATCTGGCCGAAGGGGTCGATGCCGTAGGTCTCGGGCGACAGGAG
GCGCTTGAGCTGGCTCTGGTAGCCCGCGAACTGGCGTAGCTGCTTGTCCGAGAGCGGCGGGCCGGTGCcgtcctgcgcctgctgctggcactgctccagc
tcctgcagcgagcgcttgagGCTGCGCACCTTGCGGTAGGGCCAGTGGCGGATGCCGATGGCGCGgcagcgcttcttgaaggcCGTGGCGCGCACGCCGA
ActtctcggccgccaccTTGAGCGGCAGGTGGAAGTGGCGGCTCAGCGCCGTGAAGTTGCACGTGGCCacgggcagcggcgacgccgagccgTCCGAGGC
CACGGGCGAGTCGCAggccgcgcgcttcttgaagttGTAGGCGGCCACCTGCATGCGCAGCGAATGCTGCGCCTTGTCGGCCGTGGGCGACTGGAAGGTG
AGGTGCGAGCCCCTCGAGTCGgtgggcgtgggcgtggccggcagctccatctccatcttgactagcggaggcggaggcggtgTGCTGACGTTGCCGTGCG
GAGCTCGGAGGAAATCTGGGAATGGAAgtgcagcgctgcttgcagcttgcagcCGTTTCAGATCGCACCGCTCGAAGATCGCGTTTAGAAATTTCCAGAT
TTCGGTGACCCCTACCCCCGCGAAACGGTCGTGTTACAGCCGGGCGCGCAACGTAAGGGCCTTTCTAACACCGGCAACGTAAGCTCGCTGCGAgggcgcg
gcgtcggcgaGCGAGGAAGGAAGCTGCGATGTGGATGCCTGGAAGCCATCGCTGAGGAGCGCACTCCGAGACCCCTCCGACGCCCCCATGGACTGGGCAA
TGAGCGACTCCGAGCTGGAAGGCAtcctggcggcggccagccCCGACGCTGACCTCGCTGCCCCCGACGAGTTCGAAGGCGCCCAAGCGCACAacgtcct
ccacgacgtggaTGGTCTCGAAGCCTTCGACGACCGCGACCTcttcatcgagctcgacaTCGCCGCTCCGCCGCATGCACTCTATCGCGTAGCCGCCGAG
CCGGAGCCCCCCGAGCccgtcgcagtcgctgctccGCTCGCCGCATTCCAGCATGGTAACCACCCGTTCACGCCTGCGGCTCTACCTCACCTCAACGGCA
TTCTGGCTGCGCACGCTCTCGAGGGCGATGTCTCTCCCCGCCAGCTGGGAGTGAGACTCGCAGATATGTTCATTAAtactgcagcggctgcagccgGTCT
CCCGGCTCTGGAAGCTGACGGCGATGTCGACCCTGccggcgacgtcgacgaacCCGTGCCAGCCCCGAGGTTTCGAGCCTCGGAGATTCGCTTCGTGGTC
GTGAATGCGCGAATGCGTGGCTTCATCGGACGCAATGCCCCCAGGAACACGAGGTGGATCGTCCGCATGTTCAACAAGAAGGGTCTGTACCACGTGAGAA
TCGGCCCTTTGACTGAATGGCGCGACGGCAGGCTTAGGCTCTCTCCGATAGGGCTCTGGTGCGGCCTCGACGAGGCACAAGTAGAGAGATACGACGGGGC
TTACCTGGGAAAGTGGGGGTTCACGGCTAGGCACTtcttcgagcgcttccgaGAGCTCAAGAGCTACTTCAGAAACCGAGACTTCCCTATGGAGTGCTAC
GACCTGTACTTCATGCATTGCATCTGCGGATTCAACCATGATGCGCGCGATCTGCTAGCAGGGGAGCAAGAACTCCGGAACCTCCTTTCACGAGAAGAAA
ACGTGCGATTGAGATTCTTCTACACCGGCGAGGACCCAGCGCACTTGCCGACCGGATTCAGGACCATCCGGTCCGAGATCTACGAGCTCACTTGTATATT
GGACCCTCACAGGCTACAACAAGTCGCCTCGATGTGCGCAGCCAAATTACAAGCCTTTCGTGAGGCGCACCCCCTCTCTAGAGAGGAGATTGCGAATCGG
TTGGCGGAGCTGGATGTGATGGCTGCGGCAGAATTTGAGCGGGCTGAGGCGGAACACGAACAAGCGCAAATGGATGATGAAGACTAGCTTAGCTTAGCTG
CAACGAGAAAATCATGTCCTGGGCAATGTATTTACAAAGTAGGGCAGCAACATCGCCAGGAAGCCTTGACTTTTGCCTGGCTTGCCTGCTCCGGCGTGGA
CTTGTGTGCTCTACTTGCCCTACCTGTTGTGCAACAGCGACAGCCCTGGCAGCAATTCACGGCGCAAAAGCTGCCGCCAGCGAGCTCCACATGAGCCGCG
AGTCAGCGCCCGCAGCGTAGTCCAAAGTGTCTGCGTTCCACATGCCCACGCCGCGCAGCCCGAGCTCTCGCACGAGTGCGTACTTGGCCTTGAGGCTGCG
CGGGTTGTCGAACCAAATCTGCGACCGTCCGCCCTCGGGCGGCGAGTACCACACGAACGGGGTCAGCGTCGTGGGGTCCCATTGCTCGAG